Detected as a riboswitch by 5 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA071351 Similarity: 0.963 Similarity: 0.962 Similarity: 0.962
UTR: 5HSAA071351
Gene: NDUFV2
MFE: -31.748
ENS: 0.849
Length: 142.
Predicted Ligands:
cobalamin - 12/20
FMN - 5/20
TPP - 1/20
 RS: URS000232F5E4_1048205
MFE: -53.279
Ligand: cobalamin
Species: Streptomyces uncialis Cobalamin riboswitch
 RS: URS0000C01888_1382230
MFE: -52.957
Ligand: TPP
Species: Asaia platycodi SF2.1 TPP riboswitch (THI element)
 RS: URS000231D466_307121
MFE: -62.919
Ligand: cobalamin
Species: Micromonospora krabiensis Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA071351 URS000232F5E4_1048205 URS0000C01888_1382230 URS000231D466_307121
Length 142. 140. 142. 141.
Similarity - 0.963 0.962 0.962
Ensemble Norm 0.849 - - -
MFE -31.748 -53.279 -52.957 -62.919
Ligands - cobalamin TPP cobalamin
Gene NDUFV2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7. 5. 3.
Length SE - 4. 0. 1.
Lev Distance - 41. 49. 49.
UBS 11. 13. 11. 11.
BS 0. 0. 0. 0.
ILL 4. 3. 4. 4.
ILR 2. 3. 2. 2.
H 3. 3. 3. 2.
BL 4. 3. 2. 3.
BR 5. 5. 4. 6.
UN 0.120 0. 0.120 0.113

Sequences

Field Description
UTR seq + 25 caaggugcauaagauuuuuccugaagguaauacuaacagauugggcaugggguccgaggguauucuagguggaaaggacaacuuaaagucuuguuggcaagaaaaagaucgguauguATGTTCTTCTCCGCGGCGCTCCGGG
UTR dot + 25 ..(((…………..)))……………(((..(((((((.(..((((…..((((..((.((.(((((……..))))).)).)).))))…..))))..).))))))).)))((.(((….)))))
RS 1 seq UUCGCAGCCGUGUUCCAAUCCGGCUGAUACACACUCAAGUUCAGGGGAAGCCGGUCGAACUCCGGCGCUGACCCGCAACCGUAGGCCCGUCGCACCGCGGACGGGCGAGCCGGACUGCCUGGACUUGGCUCUACGCAGCG
RS 1 dot ….((((((.(…….)))))))………((((((((((…(((((((((..((((((.((.(((..((……..))..))))).))..))).)..))).)))).)).))))))))))(((……))).
RS 2 seq GUCCAUACCAGGGGGGGCCUCGACAAGAGGCUGAGAGGCUGAUCGCGGGAUUUCCGUAGCGCAGCGACCCUUUCGCCCCGGCAUGUGGGCGAAGAACCUGAUCCGGUUCGUACCGGCGUAGGGAUUGGUGUGAGCGGCCCGG
RS 2 dot .(((……)))..((((((…..))))))………….((((….((((..((((.(((((((..((((((((.((..((……..))..))))))……..)))).)))).))).)))).)))))))).
RS 3 seq GGCACCCGGUGCACGCCGGGCACACAACUGCAUACGUCCCGUGUGGGGGGAAGCCGGUUCCAAGCCGGCGCUGACCCGCAACCGUGAGCGAGAGUCUCCCUUUCGCGAGCCGGAAUGCCCCGCCCGGGACGAGCGGCUUCC
RS 3 dot ….((((((….))))))…….((((…(((((((.((((((.(…(((((((……((.(..(((((((……..))).).))).)))……)))))))..).)))))).))))))).))))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table