Detected as a riboswitch by 4 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA071391 Similarity: 0.978 Similarity: 0.978 Similarity: 0.978
UTR: 5HSAA071391
Gene: NECAP1
MFE: -34.811
ENS: 0.724
Length: 103.
Predicted Ligands:
purine - 11/20
SAM - 3/20
TPP - 3/20
 RS: URS0000AB280B_665959
MFE: -20.667
Ligand: purine
Species: Bacillus sp. 2_A_57_CT2 Purine riboswitch
 RS: URS0000C2AA14_1402860
MFE: -20.329
Ligand: purine
Species: Bacillus enclensis Purine riboswitch
 RS: URS0000C20FD2_1564681
MFE: -23.066
Ligand: tetrahydrofolate
Species: Carnobacterium sp. CP1 THF riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA071391 URS0000AB280B_665959 URS0000C2AA14_1402860 URS0000C20FD2_1564681
Length 103. 102. 102. 103.
Similarity - 0.978 0.978 0.978
Ensemble Norm 0.724 - - -
MFE -34.811 -20.667 -20.329 -23.066
Ligands - purine purine tetrahydrofolate
Gene NECAP1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.028 8. 12.034
Length SE - 1. 1. 0.
Lev Distance - 27. 25. 25.
UBS 8. 7. 7. 7.
BS 0. 0. 0. 0.
ILL 3. 3. 4. 2.
ILR 3. 3. 3. 2.
H 2. 1. 1. 1.
BL 2. 1. 0. 4.
BR 1. 1. 2. 3.
UN 0.010 0.176 0.029 0.194

Sequences

Field Description
UTR seq + 25 gcgcuuugcaucuccgccucccgugcuccgccuccggucuuacguuucgcccccggcagcgccgacagcggacccaagATGGCGACCGAGTTGGAGTACGAGT
UTR dot + 25 (((………..)))(((..((((((((.((.(((((…((((((((…((((…))))…)))))……)))..))))))).))))))))))).
RS 1 seq AAUAAAUUAAUAACAUUCACUCAUAUAAUCGCGAGGAUAUGGCUCGCAAGUUUCUACCGGGUUACCGUAAAUGAUCCGACUAUGAGUGAGCAAUGUAAAGGA
RS 1 dot …………(((((((((((((…(((.((…(((((((((…((….))))))…)))))…..))))).)))))))))…))))……
RS 2 seq AUAGAGUUCGUUAGCAUCCUUCGUAUAUCCUCGAUAAUAUGGUUCGAAAGUUUCUACCCGGUCACCGUAAAUGACUGGACUAUGAAGGCAGUGUUCUAUUUA
RS 2 dot (((((……..((((((((((((..(((…….(((((((((…((….)).)))..))))))…….))).))))))))..)))))))))…
RS 3 seq AACAGAGUAGGAAAUAAAGCGUUAAGUGUUGAUGGGAUGGGAUGUUGCCCUCAAACGAAAAAUUGUCUUGGCAAUUUGCGGUUUUAUUUCUGCAUUCGCUGCA
RS 3 dot ……………..((((…(((((.((((((((.(.(.((((((…..((((….))))…)))))).).).))))))))…)))))))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table