Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA071392 Similarity: 0.983 Similarity: 0.983 Similarity: 0.983
UTR: 5HSAA071392
Gene: NECAP1_0
MFE: -13.367
ENS: 0.483
Length: 73.
Predicted Ligands:
fluoride - 12/20
cobalamin - 4/20
GMP - 1/20
 RS: URS0000D65E69_12908
MFE: -18.374
Ligand: GMP
Species: unclassified sequences c-di-GMP-I-UAC riboswitch
 RS: URS0002317B63_1262759
MFE: -8.529
Ligand: cobalamin
Species: Brachyspira sp. CAG:484 AdoCbl variant RNA
 RS: URS00018E1630_1202785
MFE: -17.495
Ligand: fluoride
Species: Methylacidiphilum kamchatkense Kam1 crcB RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA071392 URS0000D65E69_12908 URS0002317B63_1262759 URS00018E1630_1202785
Length 73. 74. 73. 74.
Similarity - 0.983 0.983 0.983
Ensemble Norm 0.483 - - -
MFE -13.367 -18.374 -8.529 -17.495
Ligands - GMP cobalamin fluoride
Gene NECAP1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.028 8.005 4.016
Length SE - 1. 0. 1.
Lev Distance - 19. 20. 21.
UBS 5. 6. 4. 5.
BS 0. 0. 0. 0.
ILL 1. 1. 0. 0.
ILR 0. 1. 0. 0.
H 1. 2. 2. 2.
BL 2. 2. 1. 3.
BR 4. 2. 2. 3.
UN 0.466 0.297 0.397 0.338

Sequences

Field Description
UTR seq + 25 aaaaaaaaaaaaaaaaaaaaaaaaaaaaacgccgacagcggacccaagATGGCGACCGAGTTGGAGTACGAGT
UTR dot + 25 ……………………….((.(((((..(((.((((…))).).))).))))).))……
RS 1 seq CGAGAUAAAUCCAAACCUGCCGUAAGACAGGGACGGAAAGCUACGGAUCUACAAAGAUAGCCGAGCUGCCAUGA
RS 1 dot ……………((((.(….).))))…((..((((.(((((((….))))..))))))).))….
RS 2 seq AUUUUUAUAAGAGGAAAUUGAUGUGCAACUCAUCAGCUGUGCCGCAACCGUAAAAGCCGGAACACUCAGAAAA
RS 2 dot ………………(((((…….)))))..(((.((((……….)).)).)))………
RS 3 seq CAACUAUUGGGCGAUGGGGCUCGCCGUCCGUUAACCGCCAUUUCUUUGAGAAGGCUGAUAGCUCCUACGAUUAC
RS 3 dot ………(((((……)))))….((((.(.(((.((((…)))).))).).))))…………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table