Detected as a riboswitch by 18 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA071434 Similarity: 0.951 Similarity: 0.951 Similarity: 0.950
UTR: 5HSAA071434
Gene: NEDD9
MFE: -50.784
ENS: 0.949
Length: 175.
Predicted Ligands:
cobalamin - 8/20
FMN - 5/20
lysine - 4/20
 RS: URS0002321342_1005994
MFE: -44.762
Ligand: cobalamin
Species: Trabulsiella guamensis ATCC 49490 Cobalamin riboswitch
 RS: URS0000D88F15_1690244
MFE: -43.551
Ligand: lysine
Species: Enterococcus sp. RIT-PI-f Lysine riboswitch
 RS: URS0000DAEBB8_29367
MFE: -35.902
Ligand: lysine
Species: Clostridium puniceum Lysine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA071434 URS0002321342_1005994 URS0000D88F15_1690244 URS0000DAEBB8_29367
Length 175. 176. 173. 175.
Similarity - 0.951 0.951 0.950
Ensemble Norm 0.949 - - -
MFE -50.784 -44.762 -43.551 -35.902
Ligands - cobalamin lysine lysine
Gene NEDD9 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.001 1. 5.001
Length SE - 1. 4. 0.
Lev Distance - 63. 60. 65.
UBS 11. 11. 11. 10.
BS 0. 0. 0. 0.
ILL 2. 1. 2. 2.
ILR 2. 2. 2. 1.
H 5. 5. 4. 6.
BL 3. 4. 3. 2.
BR 2. 3. 2. 3.
UN 0.177 0.205 0.179 0.154

Sequences

Field Description
UTR seq + 25 gacuugagggaggcgcugcgacugacaagcggcucugcccgggaccuucucgcuuucaucuagcgcugcacucaauggaggggcgggcaccgcagugcuuaaugcugucuuaacuaguguaggaaaacggcucaacccaccgcugccgaaATGAAGTATAAGGTGATAACCCCCG
UTR dot + 25 ..((((.((.(((.(((((………)))))))).))))))…….((((…….))))(((((((….(((..(((((((((….)))))…)))).)))…..)))))))…..((((………….))))………….(((….)))….
RS 1 seq UUGUAGCAUUCUGUUUCCGGUCUCCUGAGAGUGAAAAGGGAAUCCAGUGCAAAUCUGGAGCUGACGCGCAGCGGUAAAGACUGGCGGGAUGAGAGCAACAGACACUGUGAAAACGGGAAGUCUUCAUCCAUAAAACGCCACCCAGCCCGAAGACCUGCCGGGAUCACGUCGCAUUU
RS 1 dot …….(((((.(((.((.(((….))).)).))).)))))((((…….)))).((((…..))))………(((((((((((…….((((.((((….))))…))))))))))……)))))…..((((………))))…………..
RS 2 seq CAUUUAGGUAGAGGUCGCGAGGUUCAUUAAUCCUGCUGAGUGCAGCAACACGUUAACAGCAGAGCUAGGGAAUAUCGCCGAAACAAAGUUGGUUUUGCUAGAAUCACUCUGUUGGGCCGCAAAUGAAUAAUUUGCGGACUGUCUUAGCUUCGCUAAGUUGCGCUAUGUUUUGU
RS 2 dot ((((((.((((.(((…((……)).)))))))))))))…………..((((((((((((.(((….(((((…….)))))))).))))…..))))))))..((((((((…..))))))))…((((((((…))))))..))…………
RS 3 seq AACUUAGGUAGAGGUGCGAAACUUAAUAGUAGUAUUAUGGAGGUAAGAUCAGUGAAGUAAUACGAAAGGAUUUUUCGCCGAAGUGAAUAGCAAAUUUCUUUACUGCUGUUUACUGGGCUUAUGUAAAAUAUGCAUAAGACUGUCACAAUUUAUUUUGUGGAGAGCUAUUUUCAAU
RS 3 dot .((((..((((.(.(((………..))).).))))..))))………………(((((…..)))))((..(((((((((((………..))))))))))).))((((((((…..))))))))…..(((((……)))))((((…..))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table