Detected as a riboswitch by 9 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA071628 Similarity: 0.962 Similarity: 0.958 Similarity: 0.955
UTR: 5HSAA071628
Gene: NEURL1B
MFE: -67.390
ENS: 0.791
Length: 159.
Predicted Ligands:
FMN - 7/20
cobalamin - 6/20
Mg2+ - 2/20
 RS: URS0002324FCC_1284675
MFE: -32.317
Ligand: cobalamin
Species: Cycloclasticus sp. symbiont of Bathymodiolus heckerae Cobalamin riboswitch
 RS: URS00023280A4_1173022
MFE: -32.314
Ligand: cobalamin
Species: Crinalium epipsammum PCC 9333 Cobalamin riboswitch
 RS: URS0002322675_1765722
MFE: -54.576
Ligand: cobalamin
Species: Streptomyces silvensis Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA071628 URS0002324FCC_1284675 URS00023280A4_1173022 URS0002322675_1765722
Length 159. 159. 159. 158.
Similarity - 0.962 0.958 0.955
Ensemble Norm 0.791 - - -
MFE -67.390 -32.317 -32.314 -54.576
Ligands - cobalamin cobalamin cobalamin
Gene NEURL1B - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.001 19. 20.001
Length SE - 0. 0. 1.
Lev Distance - 47. 44. 46.
UBS 14. 13. 13. 12.
BS 0. 0. 0. 0.
ILL 4. 4. 5. 3.
ILR 6. 5. 2. 4.
H 2. 2. 2. 1.
BL 6. 4. 5. 3.
BR 5. 6. 5. 4.
UN 0.057 0.082 0.063 0.032

Sequences

Field Description
UTR seq + 25 cugccgcccgccggcucgcccgugcagcugcgaugccccggagcgucgaccccgguccuggucccuggcccgccgcguaauuagccuccgcgcgcccagagcgcgccgccgccaacgccgcgcccgacgcagcgATGGGCAACACGGTGCACCGGACCC
UTR dot + 25 ..((((…..))))…((.(((((.(((.(.(((((((..((((((..(.((((..((((…((((.((((((((………..)))))……))).))))..))))..)))).)..))))))..))..))))).).)))))))).))….
RS 1 seq AGAAUCAAGAAACGUAUUGGUUCCUUUGUAGGUUAAUUGGGAAGUAUGGUUCGCUUUUUGUUUAUUAAUGAAACGUUAUUCCAUCGCUGCCACCGCAACGGUAAUGAAAAAUAGUGGUAUUUUUUAAGCCCGGAGACCAGCCAAUACCCUUCAGUUAUU
RS 1 dot .(((((((……..)))))))……….((((((((..((((((((.(((((..(((((..((((..(((((.(((.((((.(((….))).))))…))).))).))..))))…)))))..)))).).))))).)))..))))))))..
RS 2 seq ACCUCUGAUAAGAUAACAGGGCAAAUGUGAACCGUAACACAGUAGGGAAACGUCGGUGAGAGUCCGAGGCUGUGCCGCAACUGUAAACAAGAUUUUAGGUAAAACAGUAGUGCUACCUUACUUGUAAGCCAGAAUGCCUACCUGUUACUUGCUCACUAU
RS 2 dot ..(((((………)))))…..((((…((((((..(((((.(….(((((..((((..((((.((.(.(((.(((((……………….))))).))))))))))))))….))).)).).))))).))))))….))))…
RS 3 seq CACCGGACACAAGAUGUAUGCUCGUGCUCGCUGUCGCCGCAGGGGAAUCCGGUGCAAGUCCGGAACUGUCCCGCAACGGUGUACUGGUACUCAUUUGUGCGCUCGCGCCCUUCCCUGUGCCAGUGAGUCCGACGACCUGCCGACGGCGUACCCGGAUC
RS 3 dot ..((((………(((((((((.((((((((..(.(((((((((..(((((((((((((((.(((((……)))))…)))).)))……))))).)).)…)))))))))))))))))).)))………….))))))))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table