Detected as a riboswitch by 6 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA072345 Similarity: 0.984 Similarity: 0.980 Similarity: 0.979
UTR: 5HSAA072345
Gene: NKAIN2
MFE: -17.410
ENS: 0.849
Length: 87.
Predicted Ligands:
cobalamin - 7/20
SAM - 6/20
zmp-ztp - 2/20
 RS: URS0000D82DC2_1048205
MFE: -39.449
Ligand: cobalamin
Species: Streptomyces uncialis Cobalamin riboswitch
 RS: URS0000ABA63D_908338
MFE: -21.563
Ligand: SAM
Species: Peptoniphilus harei ACS-146-V-Sch2b SAM riboswitch (S box leader)
 RS: URS0002334B2B_851
MFE: -14.377
Ligand: glycine
Species: Fusobacterium nucleatum Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA072345 URS0000D82DC2_1048205 URS0000ABA63D_908338 URS0002334B2B_851
Length 87. 86. 87. 87.
Similarity - 0.984 0.980 0.979
Ensemble Norm 0.849 - - -
MFE -17.410 -39.449 -21.563 -14.377
Ligands - cobalamin SAM glycine
Gene NKAIN2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 11.013 4.002 11.003
Length SE - 1. 0. 0.
Lev Distance - 17. 25. 24.
UBS 6. 8. 6. 5.
BS 0. 0. 0. 0.
ILL 2. 1. 0. 3.
ILR 1. 0. 1. 2.
H 2. 2. 2. 2.
BL 2. 4. 2. 0.
BR 3. 4. 3. 1.
UN 0.230 0.116 0.276 0.287

Sequences

Field Description
UTR seq + 25 acuucacgaaagugcuaugaagcagcuauuucuaacaucaaaacauccgguacugaagauggATGGGTTATTGCAGTGGCAGGTGCA
UTR dot + 25 …….((((..(((…….)))..))))………..((((.(.(((((..(((((…..))))).))))).).))))..
RS 1 seq GGAAGCCGGUGGGACUCCGGCACGGUCGCGCCACUGUAAGCCCGUACGGCCGCUCCCCGGGAGGGGACCGGUGGGCGGAGUCAGAC
RS 1 dot …….((((.((((…….)))).)))).(((…((((((.(.((((.(((((….))))).)))).))))).)))))..
RS 2 seq UUACCAUAAAGAGAAGGCGAGAGACAAGCUCAUCGACCCUUCAGCAACCUACCAUGAGGCAAGGUGCUAAUGCUUGUAUGAUGGAUA
RS 2 dot …………(((((((((((…..))).)))..)))))………((((.(.(((((………))))).).))))…
RS 3 seq GGACGAACCUCUGGAGAGCUUAUCUAAGAGAUAACACCGAAGGAGCAAAGCUAAUUUUAGCCUAAACUCUCAGGUAAAAGGACGGAG
RS 3 dot ……..((((..(((…..))).))))…..(((…((((….((((….))))…..))))..)))…………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table