Detected as a riboswitch by 3 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA072526 Similarity: 0.974 Similarity: 0.973 Similarity: 0.973
UTR: 5HSAA072526
Gene: NMD3
MFE: -32.340
ENS: 0.795
Length: 115.
Predicted Ligands:
guanidine - 9/20
TPP - 8/20
glycine - 2/20
 RS: URS0000C4C539_1538295
MFE: -44.653
Ligand: guanidine
Species: Aquabacterium sp. NJ1 Guanidine-I riboswitch
 RS: URS0000D98DC1_303698
MFE: -27.677
Ligand: TPP
Species: Penicillium steckii TPP riboswitch (THI element)
 RS: URS0000DB54E6_946333
MFE: -51.360
Ligand: guanidine
Species: Methylibium sp. NS21 Guanidine-I riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA072526 URS0000C4C539_1538295 URS0000D98DC1_303698 URS0000DB54E6_946333
Length 115. 116. 114. 114.
Similarity - 0.974 0.973 0.973
Ensemble Norm 0.795 - - -
MFE -32.340 -44.653 -27.677 -51.360
Ligands - guanidine TPP guanidine
Gene NMD3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10.006 0. 13.006
Length SE - 1. 1. 1.
Lev Distance - 30. 35. 31.
UBS 7. 9. 7. 8.
BS 0. 0. 0. 0.
ILL 1. 2. 1. 3.
ILR 2. 3. 2. 4.
H 3. 3. 3. 3.
BL 1. 3. 1. 1.
BR 2. 2. 2. 0.
UN 0.165 0.086 0.175 0.088

Sequences

Field Description
UTR seq + 25 auacgucacucgggccgcgggauuucgagcauuucgcucgcgagaucuucucuguggcggagacagccagaacuuaaggcauacagaacgATGGAGTATATGGCAGAATCCACCG
UTR dot + 25 ……..(((..(((((((((((((((((…..))))..))))))….))))))).)))…(((………)))……..((.((((………….)))).))
RS 1 seq UGAAAAGGUGGCUAGGGUUCCGGCUCCGCACAGCGGGGUGACUGGUCCGAGAGCUGCCGGCCCGAGUCGGCUGCAUACCGACACUGGCUCCACGGCGGGACAAAAGCCCGGGAGGU
RS 1 dot ……(((((((.(((..((((((((((…))))))…)))))))…)))))))..((.(.(((((…….))))).).))((((..(((………)))..))))..
RS 2 seq AGAACGCAUGACGGGUGUUCGAAGCCUCACUCGAAAGAGUCGCUUUGUUCUGAGAUAUUACCGUUAAAACUUGAUCUGGACAAUACCAGCGAAAGGACAUGCCUGUUCUAUCCU
RS 2 dot ……..(((((((((((((((((…((((….)))).))))))……)))))..))))))………((((……)))).((.((((((….)))))).))..
RS 3 seq UCACAGGAUGGCUAGGGUUCCGGCUGCCGGCACGGCAGCGCUGGUCCGAGAGCCAUCGGCCUGUCGCGGCCUUCACCGCACCAGGCUCCACGGCGGGACAAAAGCCCGGGAGAU
RS 3 dot ……(((((((.(((..((((((((((…)))))))..))))))…)))))))..((((..((((……))))..))))((((..(((………)))..))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table