Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA072652 Similarity: 0.976 Similarity: 0.975 Similarity: 0.973
UTR: 5HSAA072652
Gene: NOC3L
MFE: -26.587
ENS: 0.901
Length: 113.
Predicted Ligands:
TPP - 19/20
FMN - 1/20

 RS: URS0000AB4264_377629
MFE: -32.603
Ligand: TPP
Species: Teredinibacter turnerae T7901 TPP riboswitch (THI element)
 RS: URS0000D97BFE_1797492
MFE: -34.976
Ligand: TPP
Species: Betaproteobacteria bacterium RIFCSPLOWO2_02_FULL_67_26 TPP riboswitch (THI element)
 RS: URS0000D8319B_1660104
MFE: -42.977
Ligand: TPP
Species: Lautropia sp. SCN 69-89 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA072652 URS0000AB4264_377629 URS0000D97BFE_1797492 URS0000D8319B_1660104
Length 113. 113. 112. 115.
Similarity - 0.976 0.975 0.973
Ensemble Norm 0.901 - - -
MFE -26.587 -32.603 -34.976 -42.977
Ligands - TPP TPP TPP
Gene NOC3L - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.001 3.001 3.002
Length SE - 0. 1. 4.
Lev Distance - 31. 32. 30.
UBS 7. 8. 8. 7.
BS 0. 0. 0. 0.
ILL 2. 3. 3. 1.
ILR 1. 2. 2. 0.
H 3. 3. 3. 3.
BL 2. 2. 2. 2.
BR 2. 1. 2. 3.
UN 0.195 0.168 0.161 0.243

Sequences

Field Description
UTR seq + 25 cuucggcacgugugucauuccccgggauuucuguaguaacccugcuucuggugaacuugucuggccggcauucauuuaaggccuaaggATGAAGGCGAGAAGAAATAAAAAAC
UTR dot + 25 ….((((….)))).(((.((((((…..((((…..)))))))))).)))….(((.(((..(((((………….)))))..))).)))………….
RS 1 seq CGCUGUCCUUAGGGGUGAUUGGCCGUCGCACGGUGCAAUCUGAGACGGGAUUACCCGAACCCUUUGAACCUGAUCCGGCUAGUACCGGCGUAGGAAUAGGAUUUGCCUCUGUG
RS 1 dot ..(((….)))((((((((..(((((.((.(((…))))).)))))))))))))….(((…..((((..((((……))))..))))…)))………….
RS 2 seq ACAACACGUUGGGGGUCCUGGUUGAUGCGGAAGCGCCGCGGCAAUCGGGUGAGAAACACCCUUCGAACCUGAUACGGAUAAUACCGUCGUAGGGAAGCGUGGCCGGUCAUCC
RS 2 dot ((..(……)..))((((((((.(((((…..))))).))))))))…….(((.((((…((((..((((……))))..)))))))).)))………..
RS 3 seq AGCGCUCGCUAGGGGUCCUGGGCGGCCGCACGGGGUGUGCGGCGGUGCCGGGUGAGAGAGUCCCUCCGAACCUGAUGCGGGUAAUGCCGCCGAAGGGAAGCCGACAUGAACGCCA
RS 3 dot …((((…..))))(((((((.(((((((…..))))))).)).)))))……..(((((.((……..((((……)))))).)))))……………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table