Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA072763 Similarity: 0.991 Similarity: 0.990 Similarity: 0.990
UTR: 5HSAA072763
Gene: NOLC1
MFE: -19.022
ENS: 0.921
Length: 47.
Predicted Ligands:
SAM - 16/20
unknown - 2/20
preQ_1 - 2/20
 RS: URS0000D6AF81_12908
MFE: -8.707
Ligand: unknown
Species: unclassified sequences DUF1646 RNA
 RS: URS0000AB6041_371731
MFE: -16.788
Ligand: SAM
Species: Rhodobacter sp. SW2 SAM/SAH riboswitch
 RS: URS0000AB9E39_408172
MFE: -11.976
Ligand: SAM
Species: marine metagenome SAM/SAH riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA072763 URS0000D6AF81_12908 URS0000AB6041_371731 URS0000AB9E39_408172
Length 47. 47. 48. 48.
Similarity - 0.991 0.990 0.990
Ensemble Norm 0.921 - - -
MFE -19.022 -8.707 -16.788 -11.976
Ligands - unknown SAM SAM
Gene NOLC1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2. 3. 3.004
Length SE - 0. 1. 1.
Lev Distance - 12. 11. 11.
UBS 3. 2. 3. 3.
BS 0. 0. 0. 0.
ILL 0. 0. 1. 1.
ILR 0. 0. 1. 1.
H 2. 2. 2. 2.
BL 1. 0. 0. 0.
BR 0. 0. 0. 0.
UN 0.170 0.149 0.167 0.104

Sequences

Field Description
UTR seq + 25 agugacgcguauugccuggaggATGGCGGACGCCGGCATTCGCCGCG
UTR dot + 25 ……((((.(((((……..)))))))))((((….))))..
RS 1 seq GGUUGGGCGUAUUGCUUUCAAGAUGUGGCCUUUUUGGGUGAGGGGGC
RS 1 dot …….((((((……..))))))((((((((….))))))))
RS 2 seq CGACCGUCACAACGGCUUCCUGGCGUGGCGGAAUUUCCCAACGGAGCA
RS 2 dot …(((((((..(((….)))..)))))))…((((….))))..
RS 3 seq AAUGUUCUACAACGGCUUCCUGACGUAGGGCAAUUCUUUUUUGGAGCA
RS 3 dot ..((((((((..(((….)))..)))))))).((((…..))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table