Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA072778 Similarity: 0.937 Similarity: 0.936 Similarity: 0.935
UTR: 5HSAA072778
Gene: NONO
MFE: -58.314
ENS: 0.907
Length: 196.
Predicted Ligands:
cobalamin - 15/20
lysine - 4/20
Mg2+ - 1/20
 RS: URS0000DB0436_642227
MFE: -63.
Ligand: lysine
Species: Tatumella morbirosei Lysine riboswitch
 RS: URS000232F670_66430
MFE: -95.939
Ligand: cobalamin
Species: Streptomyces roseus Cobalamin riboswitch
 RS: URS0002315F24_1517899
MFE: -80.812
Ligand: cobalamin
Species: Kytococcus sp. CUA-901 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA072778 URS0000DB0436_642227 URS000232F670_66430 URS0002315F24_1517899
Length 196. 195. 195. 197.
Similarity - 0.937 0.936 0.935
Ensemble Norm 0.907 - - -
MFE -58.314 -63. -95.939 -80.812
Ligands - lysine cobalamin cobalamin
Gene NONO - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8. 18. 17.
Length SE - 1. 1. 1.
Lev Distance - 79. 76. 77.
UBS 11. 9. 13. 10.
BS 6. 6. 4. 6.
ILL 0. 1. 2. 3.
ILR 3. 2. 5. 2.
H 4. 4. 3. 3.
BL 7. 6. 6. 5.
BR 6. 5. 6. 7.
UN 0.128 0.118 0.118 0.117

Sequences

Field Description
UTR seq + 25 accgagcuccgucgucucguuuccggcggucgcgcgcucuuuucucgggacgggagaggccguguagcgucgccguuacuccgaggagauaccagucgguagaggagaagucgagguuagagggaacugggaggcacuuugcugucugcaaucgaaguugagggugcaaaaATGAGGAAACTATTTGAGAAATATG
UTR dot + 25 .((.((.(((.((.(((((((((((((((.(((((((.(((((((((…)))))))))..)))).)))))))))…((((((((…..))..)))).))….)))).)))))…)).))).)).))..(((((((((…..))))………..)))))..((((.((….))))))……….
RS 1 seq UAGACCAGAAGAGGCGCGUCACCCAGGCAGUAUGUCAGAGGAACCGUAUCCAUUGACGACAUACCAUGGGGAGUGACGCCGAGGCUGCAAACAUGCGGUGUGUUUGUCUGUCGACUACAGGGGCUGAAUCCUCUGGGUUGUCACUGUCGUAGCGUUUAUAAUGAACGUUUAUCAAGGUGGGGCGCUUCUGGCUGA
RS 1 dot …..(((.((((((((.(((((((((..((.((((((.(((……))).))))))))…)).))((.(((((((((..(((.((((((((…..))))))))..)))…..((((((……))))))))).)))))).))..((((((((…))))))))……))))).))))))))..))).
RS 2 seq CUAGGGUCAACGGGCCUUGGUGUACGGGAAACCGGUGGAAAACCGGUGCGGCCCUCGCCACUGUGAACGGGAAGUCCGGUUCCAUUCCUUCGGGAAGCCACUGGGCGGCGCGGAGGGUUCCGCACCGCCCGGGAAGGCGGAGCCGGGGCACCAGCACCCGUGAGCCAGGAGACCGGCCGGGGCGCGUUGUCCAUC
RS 2 dot ….((.(((((.((((((((…(((….((((.((((((((((.((..(((((((….))))..)))..))))))))…)))).))))…(((.((((((((.(((((….))))).))))))))…)))((..(((((((….)).)))).)..))……))))))))))).))))).))…
RS 3 seq UGGUAGCCUGCCCAGCGAGGUCCAUCUGGGGAAAGCCGGUGAGAGUCCGGCACUGACCCGCAACCGUGAGGCGCAUGCGCCGCAGUCGGACUGCCCACUGGCCCUCGGCUCACACACCCGUCGAGGUCUGCGGGAGGGCCAGCCGACGCAGGUCGAUGCUGCUCUUCGAGACGGACCGUCACGAAAGGCUCUCUCAU
RS 3 dot .((((((((((…((..(((((.((((.(((..(((((((.(((((((..((((…((((..(((…)))..))))…)))))))))).).)))))))(((((((……….)))))))))).)))).))))).))….))))))…))))(((.((((.((((…)))).)))).)))……..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table