Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA072788 Similarity: 0.960 Similarity: 0.958 Similarity: 0.955
UTR: 5HSAA072788
Gene: NONO_0
MFE: -60.476
ENS: 0.962
Length: 173.
Predicted Ligands:
cobalamin - 9/20
Mg2+ - 4/20
lysine - 3/20
 RS: URS00023136C7_1662190
MFE: -60.826
Ligand: cobalamin
Species: Synechococcus sp. GFB01 Cobalamin riboswitch
 RS: URS000232D24D_1121306
MFE: -29.367
Ligand: cobalamin
Species: Clostridium collagenovorans DSM 3089 Cobalamin riboswitch
 RS: URS0000C134A6_1449336
MFE: -33.134
Ligand: lysine
Species: Carnobacterium divergens DSM 20623 Lysine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA072788 URS00023136C7_1662190 URS000232D24D_1121306 URS0000C134A6_1449336
Length 173. 174. 173. 173.
Similarity - 0.960 0.958 0.955
Ensemble Norm 0.962 - - -
MFE -60.476 -60.826 -29.367 -33.134
Ligands - cobalamin cobalamin lysine
Gene NONO - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.002 5.002 14.007
Length SE - 1. 0. 0.
Lev Distance - 49. 54. 53.
UBS 11. 12. 12. 10.
BS 0. 0. 0. 0.
ILL 4. 6. 3. 5.
ILR 4. 3. 5. 6.
H 1. 1. 1. 1.
BL 4. 4. 3. 2.
BR 4. 4. 5. 2.
UN 0.162 0.201 0.121 0.081

Sequences

Field Description
UTR seq + 25 aaucgagaacgccauuuuguaccccuuggcaggcaccgagcuccgucgucucguuuccggcggucgcgcgcucuuuucucgggacgggagaggccguguagcgucgccguuacuccgaggagauaccagucgguagaggggugcaaaaATGAGGAAACTATTTGAGAAATATG
UTR dot + 25 ………(..(((((((((((((((…….(((((.((..(((.(((((….((((((.(((((((.(((((((((…)))))))))..)))).)))))))))……))))).)))…))))))).))))))))))))).))..)……………….
RS 1 seq CACCGAUACUGCAUGAGGGGUUCUCCGGAUCCAGACCGGGGAGGCAACGAGGAAAGUCCGGUGGCGGGAGUCUCUCCCCAGUCCGGCACUGUCCCGCAGCUGUGAUGGCCCCGCCGCCUGCCCCCCAGGCCGGCCCGCCUCAGUCAGAACGCUCGCCCCAUCCACCACCUUUCG
RS 1 dot ……..(((..(((((.(….((((…….((((((.((((………….(((((((((.(((..((..((((.(((…….)))..)))).)).)))))))))))))))))))).))))))..).)))))..)))………………………
RS 2 seq UAAAUAAUUAAGGAUUUAGGUUCAUGAUGAUUAAAAGGGAAAGAGGUGUAAGUCCUCUACAGCCCCCGCUACUGUAAGAAAAUACGAACCCCAGAUAGCCACUGAUAACUCGGGAAGGUUGGGAAGUAGGAUGAAGUUCGAGUCAGGAGACCUACCUAAGUCUAAGAGUAGUA
RS 2 dot ………..((((((((((((.((((..(………..(((.(….(((((((.(((((((((((((((……………..))).))))…………)))..)))))…)).)))))..).)))).)))).))…..))))))))))……….
RS 3 seq AUAAAAAAUAGAGGUGCAACAAUUAUCAGUAAUUAGUUGGAGGUUUGACAAAACCUGUGAAGACUAGUGAAAGGAAUUUUUGCCGAAACAAAAAACUGUCAUCUUUUUGUUGGGUCUUAGGUUGAAUAAGCCGAGAACUGUCGCUUAUCUUUAAGCGUUGCGCUAUCUUACUG
RS 3 dot ………(((((((((((..(((…((((.(((((…((((((….((((((…(((((((((((((((.((((((……))))))…….)))))))))))).)))))))))…))))))…)))))….))))…)))..)))))))).)))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table