Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA072790 Similarity: 0.976 Similarity: 0.975 Similarity: 0.974
UTR: 5HSAA072790
Gene: NOP10
MFE: -33.879
ENS: 0.995
Length: 113.
Predicted Ligands:
TPP - 14/20
SAM - 2/20
cobalamin - 1/20
 RS: URS0000C5DC23_1736531
MFE: -37.496
Ligand: TPP
Species: Devosia sp. Root413D1 TPP riboswitch (THI element)
 RS: URS0000DA9597_1903686
MFE: -19.672
Ligand: TPP
Species: Jeotgalibaca sp. PTS2502 TPP riboswitch (THI element)
 RS: URS0000DA91C6_1993
MFE: -42.887
Ligand: TPP
Species: Actinomadura madurae TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA072790 URS0000C5DC23_1736531 URS0000DA9597_1903686 URS0000DA91C6_1993
Length 113. 114. 112. 113.
Similarity - 0.976 0.975 0.974
Ensemble Norm 0.995 - - -
MFE -33.879 -37.496 -19.672 -42.887
Ligands - TPP TPP TPP
Gene NOP10 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10.002 9. 8.001
Length SE - 1. 1. 0.
Lev Distance - 27. 28. 32.
UBS 10. 10. 10. 9.
BS 0. 0. 0. 0.
ILL 1. 2. 1. 3.
ILR 3. 5. 3. 4.
H 1. 1. 1. 1.
BL 2. 4. 5. 3.
BR 5. 4. 5. 4.
UN 0.044 0.088 0.062 0.071

Sequences

Field Description
UTR seq + 25 aggaaauugacgaacacgugacgcggucgggcggaccacugcagacugagcgguggaccgaauugggaccgcuggcuuauaagcgaucATGTTTCTCCAGTATTACCTCAACG
UTR dot + 25 (((((((((..(((.(((((((((((((((((((.(((((((…….))))))).)))………).))))))…..))).)))))))))..)))).)).)))…..
RS 1 seq CGCCAUCCACAGGGGUGCUCCGUAUUGCCGGGGCUGAGAUGCGGCACGCUAAGUGCGCGGACCCUAAAGCUGAUCUGGGUAAUACCAGCGGAGCGAGGCGGGCGAUGUUUUCCG
RS 1 dot ((((..((…….((((((((((((((.(((((.((.(.((((((…..)))).)).)..))..)))….)).))))))….)))))))).))..))))……….
RS 2 seq AUUAAGCACUGGGAGCGCUGAGUAGUUCAGCUGAGAGAAAGAUACGAUUACAUCUUUGAUCCCUAUACCUGAUCUAGAUAAUACUAGCGUAGGAAAGUGUAUAAUAUUAAGC
RS 2 dot ((((.(((((….(((((.(((((.((((.((((.(((((((……..)))))…)).)).)).)))).))…….))))))))…..))))).))))…….
RS 3 seq AGCACAGAGCGCGGGAGUCCGGUACGACCGGGCUGAGAGGGCGGCUGAACGGGCCGCCGACCGCCAGACCUGAUCCGGAUCAUGCCGGCGAAGGGAGCGCGCAUGCAGAUCGU
RS 3 dot .(((..(.((((……((((((.((((((((((.(..(((((((…..)))))))..)…)))……))))).)).))))))……..)))).).)))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table