Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA072814 Similarity: 0.965 Similarity: 0.963 Similarity: 0.963
UTR: 5HSAA072814
Gene: NOP2
MFE: -46.138
ENS: 0.941
Length: 137.
Predicted Ligands:
cobalamin - 8/20
molybdenum - 3/20
glycine - 3/20
 RS: URS0000C43A3C_1660139
MFE: -63.445
Ligand: zmp-ztp
Species: Rubrivivax sp. SCN 70-15 ZMP/ZTP riboswitch
 RS: URS0000D7E155_1797674
MFE: -41.507
Ligand: molybdenum
Species: Chloroflexi bacterium RIFOXYC12_FULL_59_14 Moco (molybdenum cofactor) riboswitch
 RS: URS0000D9CF2F_1805002
MFE: -41.507
Ligand: molybdenum
Species: Anaerolineae bacterium CG1_02_58_13 Moco (molybdenum cofactor) riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA072814 URS0000C43A3C_1660139 URS0000D7E155_1797674 URS0000D9CF2F_1805002
Length 137. 137. 136. 136.
Similarity - 0.965 0.963 0.963
Ensemble Norm 0.941 - - -
MFE -46.138 -63.445 -41.507 -41.507
Ligands - zmp-ztp molybdenum molybdenum
Gene NOP2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8.006 8.012 8.012
Length SE - 0. 1. 1.
Lev Distance - 44. 46. 46.
UBS 6. 5. 6. 6.
BS 5. 6. 4. 4.
ILL 1. 1. 0. 0.
ILR 1. 2. 1. 1.
H 2. 2. 3. 3.
BL 3. 5. 5. 5.
BR 6. 5. 5. 5.
UN 0.212 0.131 0.103 0.103

Sequences

Field Description
UTR seq + 25 gugcgccugcguggaacgauucuguggcgagugccggccgaaagcuagguccggauugcacguggagggccgcccgaagggcacucucggacauuaacccgcauucuguaccATGGGGCGCAAGTTGGACCCTACGA
UTR dot + 25 .(((((((.(((((.((((…(((((((.(((((((((……..)).)))….)))).))(((((..((((…)))).)))))……….))))).)).)).))))))))))))……………
RS 1 seq CGCAGCCUGCGCGACUGGCGAUACGGGGCGGCGGCCGGAAGUCCGACCUCCCUCGAGGUGGACGACCACCGGGGAGCGCAGCCGGCAGCGCUCACUAUCCCUGCCGCCGGUGCCUGCCGUUCGCCUGGGCAACCCUC
RS 1 dot ….(((((.((((.(((((….((.((((((((.((..((((.(((((….)))))))))..))…(((((((((……..))))))…..))).))))))).).))))))).)))).)))))…….
RS 2 seq ACUGAAUCAUCUCUCCGAAGCCUGCCUGCCUAAACUUCACAGCAUGGCAAGCAGGCCGAUCACACAAUCGUGAUCCAGGAUUCGACGGAAACGUUGUGUCCCCCCAUGUUUGGAAAGGAGACUCAACCUAUGCUUU
RS 2 dot ..(((.((.(((.((((((((((((.((((……………)))).)))))).((((((……))))))((((((.(((((….))))).))))…..)))))))).))).)).)))………..
RS 3 seq ACUGAAUCAUCUCUCCGAAGCCUGCCUGCCUAAACUUCACAGCAUGGCAAGCAGGCCGAUCACACAAUCGUGAUCCAGGAUUCGACGGAAACGUUGUGUCCCCCCAUGUUUGGAAAGGAGACUCAACCCAUGCUUU
RS 3 dot ..(((.((.(((.((((((((((((.((((……………)))).)))))).((((((……))))))((((((.(((((….))))).))))…..)))))))).))).)).)))………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table