Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA072878 Similarity: 0.983 Similarity: 0.981 Similarity: 0.979
UTR: 5HSAA072878
Gene: NOSIP
MFE: -22.204
ENS: 0.987
Length: 84.
Predicted Ligands:
zmp-ztp - 9/20
cyclic-di-GMP - 4/20
Mg2+ - 2/20
RS: URS0000C78052_1131731
MFE: -27.721
Ligand: Mg2+
Species: Bacillus azotoformans LMG 9581 ZMP/ZTP riboswitch
RS: URS0000C6378C_1408103
MFE: -23.521
Ligand: zmp-ztp
Species: Bacillus campisalis ZMP/ZTP riboswitch
RS: URS0000D6C88C_12908
MFE: -21.657
Ligand: GMP
Species: unclassified sequences c-di-GMP-I-UAC riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA072878 URS0000C78052_1131731 URS0000C6378C_1408103 URS0000D6C88C_12908
Length 84. 84. 83. 85.
Similarity - 0.983 0.981 0.979
Ensemble Norm 0.987 - - -
MFE -22.204 -27.721 -23.521 -21.657
Ligands - Mg2+ zmp-ztp GMP
Gene NOSIP - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10.001 3.005 7.001
Length SE - 0. 1. 1.
Lev Distance - 20. 23. 25.
UBS 5. 5. 6. 6.
BS 0. 0. 0. 0.
ILL 0. 2. 1. 2.
ILR 2. 1. 2. 2.
H 3. 3. 3. 3.
BL 2. 0. 2. 1.
BR 0. 1. 1. 1.
UN 0.024 0.060 0.096 0.047

Sequences

Field Description
UTR seq + 25 uuuccggugucggggcacaguugaagaagcgaccgagggacugggagucguuagugaggATGACGCGGCATGGCAAGAACTGCA
UTR dot + 25 .(((((((.((((.((…………))..))))…)))))))((((((……))))))((((………..)))).
RS 1 seq AAAGCUAUAUGUGACUGGCGAGACGCGGACGAACCGCGAGGGAGCAUAUAGUGACGGAAAUGGCCGUUCGCCUGGGCUGAGGUA
RS 1 dot …(((((((((..((…….(((((…..))))).))..)))))))))(((((……))))).((((……)))).
RS 2 seq AUGGCCGUGUGUGACUGGCGAGAGCGGAUAACCGCAAGGGAGCACAUUGCAUCGGAGCAAAGCCGUUCGCCUGGGCAGAGGUA
RS 2 dot …((.((((((..((.(((…………)))..))..)))))).))….((((……))))((((……)))).
RS 3 seq GUUGUGAAAUGCAAAAUAGACGAAAGUCUGUGACGCAAAACUACAGGGCCUAAUUCCGUAUGGAAAUGGCAGCCAGUUGCCGCUG
RS 3 dot .(((((…(((…((((((….))))))…)))….)))))…(((.((((….)))).)))((((……..))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table