Detected as a riboswitch by 11 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA072880 Similarity: 0.952 Similarity: 0.952 Similarity: 0.951
UTR: 5HSAA072880
Gene: NOSIP_0
MFE: -26.906
ENS: 0.863
Length: 164.
Predicted Ligands:
Mg2+ - 9/20
TPP - 4/20
cobalamin - 3/20
 RS: URS0000AB961F_913865
MFE: -38.942
Ligand: Mg2+
Species: Desulfosporosinus sp. OT M-box riboswitch (ykoK leader)
 RS: URS0000C79885_646529
MFE: -40.943
Ligand: Mg2+
Species: Desulfosporosinus acidiphilus SJ4 M-box riboswitch (ykoK leader)
 RS: URS0000C4FAA8_1420901
MFE: -45.451
Ligand: TPP
Species: Pseudogymnoascus sp. VKM F-3775 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA072880 URS0000AB961F_913865 URS0000C79885_646529 URS0000C4FAA8_1420901
Length 164. 165. 166. 165.
Similarity - 0.952 0.952 0.951
Ensemble Norm 0.863 - - -
MFE -26.906 -38.942 -40.943 -45.451
Ligands - Mg2+ Mg2+ TPP
Gene NOSIP - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 9. 4. 7.001
Length SE - 1. 4. 1.
Lev Distance - 58. 57. 61.
UBS 12. 10. 12. 13.
BS 0. 0. 0. 0.
ILL 4. 3. 3. 5.
ILR 4. 5. 5. 5.
H 3. 2. 2. 3.
BL 4. 3. 5. 2.
BR 3. 2. 3. 3.
UN 0.061 0.073 0.072 0.085

Sequences

Field Description
UTR seq + 25 aaaaccagaaacauugcugauaugaccacaauaccaucaucacacuuuaaaagaacaaccguaauucuagacuacuauccauuacguggugcagagucaaguccaguguaacuguggguuuguuggaaucaggauauagATGACGCGGCATGGCAAGAACTGCA
UTR dot + 25 ….(((.(.((((((..(((.((((…..(((((…………………..((((((..(((….)))…)))))))))))….)))).)))))))))…).)))…((((((.(((……..)))..).)))))..(((…..))).
RS 1 seq UCUAUUCUCUGUUAGGUGAGGCUCCUGCAUAAACAUAGGCCACUGCCCAGAAAUGUCGAGAGACGCCAACGGGUAGAACAGGUACUACCGACAUAAGGUUUUACUUAAUGUGGCUGAGAAAACUCUACGCUAUGCAGUGCUAAAGCUCAACGAGUAGGGAGGUCC
RS 1 dot ….(((((((((((((((((((…………((((((.((((((…..((((….))))…..))))))….))).)))………))))))))))))))…..)))))..((((((.(..((.(((……)))))..).))))))……
RS 2 seq AUGAAUCUCUGUUAGGUGAGGCUCCUGCAUAUACAUAAGCCACUGCCCAGAAAUGUCGAGAGACGCCAAUUGGGUAGAACAGGUAUUGCCGGCAUAAGGUUUUACUUAAUGUGGCUGAGAUAACUCUACGCUAUGCAGUGCUAAAACUCAACGAGAAGGGAGGUCA
RS 2 dot ….(((((((((((((((((((((.(((.((((……..((((((((…((((….))))….))))))))…..))))))).))…..))))))))))))))…..)))))..((((.(.(..((.(((……)))))..).).))))……
RS 3 seq UGGCUUCACUACGGGCGCUGAACCUGGUAAAUAACUGUGAUACACCUCAUUCUCUAUGAUCACAUAGGGAGAGAUAUCUUAGUGUUUUGCCCAGGUGACGCUGAGAUUGUACCGUGAUUACUCGAUCAAGUUAAUGCUUGCGUGGGAAAGUGCUGCCGCCUCGAA
RS 3 dot …..((((((((((((….((((((((((..((((.((((…(((..((((((((….))))))))))).)))).))))..)))))).))))..))))…..))))..))))…((((..(((((….)))))..))))..((.((….))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table