Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA073014 Similarity: 0.977 Similarity: 0.973 Similarity: 0.972
UTR: 5HSAA073014
Gene: NPHP1
MFE: -55.867
ENS: 0.705
Length: 119.
Predicted Ligands:
cobalamin - 4/20
SAM - 4/20
TPP - 4/20
RS: URS0000C6EA61_1423718
MFE: -27.051
Ligand: FMN
Species: Lactobacillus agilis DSM 20509 FMN riboswitch (RFN element)
RS: URS0000ABC28C_521096
MFE: -52.507
Ligand: methionine
Species: Tsukamurella paurometabola DSM 20162 S-adenosyl methionine (SAM) riboswitch,
RS: URS0000AB570E_469381
MFE: -38.028
Ligand: cobalamin
Species: Dethiosulfovibrio peptidovorans DSM 11002 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA073014 URS0000C6EA61_1423718 URS0000ABC28C_521096 URS0000AB570E_469381
Length 119. 120. 121. 118.
Similarity - 0.977 0.973 0.972
Ensemble Norm 0.705 - - -
MFE -55.867 -27.051 -52.507 -38.028
Ligands - FMN methionine cobalamin
Gene NPHP1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8.002 7.002 5.002
Length SE - 1. 4. 1.
Lev Distance - 27. 28. 34.
UBS 9. 10. 10. 9.
BS 0. 0. 0. 0.
ILL 3. 4. 3. 2.
ILR 1. 2. 2. 2.
H 2. 2. 2. 3.
BL 2. 3. 3. 1.
BR 4. 2. 2. 3.
UN 0.092 0.133 0.050 0.136

Sequences

Field Description
UTR seq + 25 cugggaggcgggcgcacaucgauggcgucaccuucuggcgccgccgguugguuucccuggcaacuggagcaaucagagcaccgcagccagggagATGCTGGCGAGACGACAGCGAGATC
UTR dot + 25 ((((((((..(((((.((….))))))).))))))))((((((((((..(((((((((((…(((.((…….)).)))..)))))))))))))))))).).))………..
RS 1 seq GUUUAUCUUCAGGGCAGGGUGAAAAUCCCGACCGGCGGUAAAAGUCCGCGACCCUUGUUUAAGGUUGAUUCGGUGCAAUUCCGAAACCGACAGUGAUAGUCUGGAUGGAAGAAGAUAGUA
RS 1 dot .((((((.((..((..(((…….)))..)))).)))))).(((((.(((.((((((…(((…(((((…….))))))))))))).)…))))))))…………..
RS 2 seq GGUCAUGAGCGUCAGCGUGGAGCCCCGGCUUGCUGACCGGCAACCCUCCGCCGCGGUGGGGUGCCCCGGGUGAUGACCAGGUUUCUCGGCGGUCAGCCCCGUCGGGCGGCAAACGCGAGAA
RS 2 dot ((((…((((..(((.(((….)))))))))))))).((……(((((.(((((((((((((((((.(((……))).))))).)))..))))))))))))))…..))…..
RS 3 seq CAGGAAGCCGGUGAAAAUCCGGCACAGCCCCGCUACGGUUAGGAUGACGACGGAGACACACCGCCUCUGACUUCGGUCGGAAAGGCGUCUCCUAGGUUGAAUCCAAGUCCGGAUACUG
RS 3 dot ……(((((…….)))))..(((…))).(((((.((((..((((((((((…..((((((((……)))))..)))))))))…)))).)))).)).)))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table