Detected as a riboswitch by 5 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA073025 Similarity: 0.980 Similarity: 0.980 Similarity: 0.979
UTR: 5HSAA073025
Gene: NPHP3
MFE: -37.189
ENS: 0.847
Length: 102.
Predicted Ligands:
TPP - 8/20
tetrahydrofolate - 6/20
purine - 3/20
 RS: URS00022E0D0A_137838
MFE: -24.950
Ligand: tetrahydrofolate
Species: Clostridium neonatale THF
 RS: URS0000D989BC_1520813
MFE: -38.861
Ligand: TPP
Species: Paracoccus sp. SM22M-07 TPP riboswitch (THI element)
 RS: URS0000AB8EC8_1263012
MFE: -37.909
Ligand: tetrahydrofolate
Species: Firmicutes bacterium CAG:24 THF riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA073025 URS00022E0D0A_137838 URS0000D989BC_1520813 URS0000AB8EC8_1263012
Length 102. 102. 103. 102.
Similarity - 0.980 0.980 0.979
Ensemble Norm 0.847 - - -
MFE -37.189 -24.950 -38.861 -37.909
Ligands - tetrahydrofolate TPP tetrahydrofolate
Gene NPHP3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.002 6.008 2.
Length SE - 0. 1. 0.
Lev Distance - 25. 24. 27.
UBS 8. 7. 6. 8.
BS 0. 0. 0. 0.
ILL 2. 1. 1. 1.
ILR 3. 4. 2. 3.
H 2. 1. 2. 1.
BL 2. 2. 2. 2.
BR 2. 1. 2. 2.
UN 0.039 0. 0.126 0.049

Sequences

Field Description
UTR seq + 25 ucugccccaccccgucccguuccguuccgcugcccaguccugcugguacucacuagguaguagcggcaacggacgccATGGGGACCGCCTCGTCGCTCGTGA
UTR dot + 25 …((….((((((..(((.(((((((((((((((((…)))))………….))))))).))))))))..))))))…))(.((…..)).).
RS 1 seq UACAGAGUAGGUAUUUGUGCGUCAAGUGUUAAGAGGACGGGAAGUUGUCUCUUAAACGAAAAACUCUAGCAGUUUGCGGUACAAAUAUUGCAUUCCGCUGUA
RS 1 dot ((((((((.(((((((((((..((((((((.(((((((((….)))))…………..)))))))).))))..)))))))))))..))))…))))
RS 2 seq UGCAAACCGUUGGGGUGUCCCGUCACAGGGGCUGAGAGGCGUCAGCCAACCCAUCGAACCUGAUCCGGGUCAUACCGGCGGAGGGAACGGUGCAGAUGAUCGC
RS 2 dot ……(((((((.(((.((((…((((((((((……))))))………..))))…)))).))).)))))))……((((…….)))).
RS 3 seq UGCAGAGUAGGUUUGUAUGCGUUAAGUGCCGGCAGGACAGAGAGUUGCCUGUUGGACGAAAAGCCGGUUCGGCUUGCGGUAUACAGACCGCAUCUCGCUGCA
RS 3 dot .(((((((.(((((((((((..((((((((((((((.(((….))))))…………))))))…)))))..))))))))))))).))).))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table