Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA073044 Similarity: 0.979 Similarity: 0.978 Similarity: 0.978
UTR: 5HSAA073044
Gene: NPHP3_0
MFE: -34.370
ENS: 0.901
Length: 84.
Predicted Ligands:
zmp-ztp - 8/20
SAM - 3/20
GMP - 2/20
 RS: URS0000C75E51_68231
MFE: -36.526
Ligand: zmp-ztp
Species: Streptomyces longwoodensis ZMP/ZTP riboswitch
 RS: URS0000C34F8E_1423763
MFE: -15.784
Ligand: SAM
Species: Lactobacillus kalixensis DSM 16043 SMK box translational riboswitch (SAM-III)
 RS: URS0000ABBD20_1036672
MFE: -24.497
Ligand: homocysteine
Species: Advenella kashmirensis WT001 S-adenosyl-L-homocysteine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA073044 URS0000C75E51_68231 URS0000C34F8E_1423763 URS0000ABBD20_1036672
Length 84. 84. 86. 82.
Similarity - 0.979 0.978 0.978
Ensemble Norm 0.901 - - -
MFE -34.370 -36.526 -15.784 -24.497
Ligands - zmp-ztp SAM homocysteine
Gene NPHP3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8.009 2.030 9.002
Length SE - 0. 4. 4.
Lev Distance - 26. 24. 22.
UBS 6. 7. 5. 6.
BS 0. 0. 0. 0.
ILL 0. 1. 0. 0.
ILR 1. 3. 1. 1.
H 2. 2. 2. 2.
BL 0. 1. 0. 3.
BR 3. 2. 2. 3.
UN 0.012 0.107 0.186 0.061

Sequences

Field Description
UTR seq + 25 guuccguuccgcugcccaguccugcugguacucacuagguaguagcggcaacggacgccATGGGGACCGCCTCGTCGCTCGTGA
UTR dot + 25 ((((((((((((((((((((…)))))………….))))))).)))))).))(((((((((……))).)))))).
RS 1 seq GGGGCGGGCCGUGACUGGCGCUGAGGUGGAGCACCACCGGGGAGCGGUCCGUGACCCCUCAUGCCGUGCGCCUGGGCGACACCG
RS 1 dot ((((((((((((..((((.(((…….))).)))….)..))))))))…))))…….((((((….))).)))..
RS 2 seq AGUCGGUUCAAGUCCUGAUAGGAUUCAUUUAUUGAAGAUGCCUUGUAACCGAAUAGCUUUUAGCCUAUAUAGGGGGACUAUUUAUG
RS 2 dot ..((((((((((((((…))))………………)))).))))))……..((((((…….))).)))……
RS 3 seq UGUCCUGAGGGGCGUUGCGACAUGACUUACCCGUCAUGCCAGGCUCAGGAUACGAUCAGGUAACGAACCGCGCUCAUCAUAU
RS 3 dot (((((((((.(((((.(((…………))).)))))…))))))))).(((.((((……..)).)).)))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table