Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA073235 Similarity: 0.971 Similarity: 0.964 Similarity: 0.964
UTR: 5HSAA073235
Gene: NR1H2
MFE: -28.051
ENS: 0.885
Length: 128.
Predicted Ligands:
FMN - 7/20
cobalamin - 5/20
TPP - 5/20
 RS: URS0000DA7F57_1048205
MFE: -54.569
Ligand: cobalamin
Species: Streptomyces uncialis Cobalamin riboswitch
 RS: URS0000DB31BE_1161099
MFE: -44.156
Ligand: TPP
Species: Corynebacterium appendicis CIP 107643 TPP riboswitch (THI element)
 RS: URS0002314601_1618364
MFE: -37.467
Ligand: cobalamin
Species: Candidatus Amesbacteria bacterium GW2011_GWC1_47_15 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA073235 URS0000DA7F57_1048205 URS0000DB31BE_1161099 URS0002314601_1618364
Length 128. 128. 127. 129.
Similarity - 0.971 0.964 0.964
Ensemble Norm 0.885 - - -
MFE -28.051 -54.569 -44.156 -37.467
Ligands - cobalamin TPP cobalamin
Gene NR1H2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 11.004 6.018 4.007
Length SE - 0. 1. 1.
Lev Distance - 36. 45. 46.
UBS 6. 8. 8. 6.
BS 0. 0. 0. 0.
ILL 1. 3. 2. 2.
ILR 1. 2. 1. 2.
H 4. 3. 5. 4.
BL 1. 1. 1. 0.
BR 1. 2. 1. 0.
UN 0.031 0.094 0.165 0.116

Sequences

Field Description
UTR seq + 25 guugccggaagaaguggcgaaguuacuuuugaggguauuugaguagcggcggugugucaggggcuaaagaggaggacgaagaaaagcagagcaagggaacccaATGTCCTCTCCTACCACGAGTTCCC
UTR dot + 25 .((((((…….)))))).(((((((…………)))))))(((…..))).((((((..((.(((((((……………………….))))))).))……)))))).
RS 1 seq AGAGGAAGCCGGUGCGAAUCCGGCGCGGUCCCGCCACUGUCACCGGGGAGCGCUCCCCCACACCGGAUGUCACGGCCCGCAGGGGCUGGAAGGCCGGGGGCGGCGCCGAUCCGGAAGCCAGGAGACUC
RS 1 dot …….(((((…….))))).((.((((………….)))).))((((……((((((….((((((((…((((….))))….)))).))))))))))……))))….
RS 2 seq AGGCGUGACACGGGGUGCCACCGUGGCUGCGUGAGGCAGGUGCGGCGCCGGGAGGCGAUGGCUGAGAUGACACCCGUUGAACCUGAUCCAGUUAGCACUGGCGGAGGGAUGGUCGCGAGAACGCGUG
RS 2 dot .(((((……..))))).(((((.((((…..)))).)))))((((….))))…………….(((((…(((…(((((….)))))…)))))))).((((….))))..
RS 3 seq GAUAAUUUGAUUGCAGGUUGUGUUUAAGGAAACGGGGUGUGAUUCCCCUGCUGUGCCGCAACUGUAAGCUACAAGCGGUUGACACGCUUGUAGUAAAGCCAGAAAACUAACAGCCUCUUAUUCCCGAGC
RS 3 dot .((((((((….))))))))…………((((…….)))).(((((…….(((…((((((((((…….))))))))))…..)))…….)))))(((……..))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table