Detected as a riboswitch by 3 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA073622 Similarity: 0.954 Similarity: 0.951 Similarity: 0.949
UTR: 5HSAA073622
Gene: NSUN6
MFE: -40.068
ENS: 0.770
Length: 173.
Predicted Ligands:
cobalamin - 6/20
lysine - 6/20
glucosamine - 3/20
 RS: URS000232CD92_273035
MFE: -28.081
Ligand: cobalamin
Species: Spiroplasma kunkelii CR2-3x Cobalamin riboswitch
 RS: URS0002331D22_485916
MFE: -46.027
Ligand: cobalamin
Species: Desulfotomaculum acetoxidans DSM 771 Cobalamin riboswitch
 RS: URS0000DAE646_1797677
MFE: -42.508
Ligand: lysine
Species: Clostridiales bacterium GWB2_37_7 Lysine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA073622 URS000232CD92_273035 URS0002331D22_485916 URS0000DAE646_1797677
Length 173. 172. 173. 173.
Similarity - 0.954 0.951 0.949
Ensemble Norm 0.770 - - -
MFE -40.068 -28.081 -46.027 -42.508
Ligands - cobalamin cobalamin lysine
Gene NSUN6 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 9. 3. 8.004
Length SE - 1. 0. 0.
Lev Distance - 56. 65. 65.
UBS 11. 12. 12. 13.
BS 0. 0. 0. 0.
ILL 2. 4. 2. 2.
ILR 2. 2. 2. 3.
H 5. 5. 6. 6.
BL 4. 2. 4. 3.
BR 2. 2. 3. 3.
UN 0.191 0.198 0.208 0.127

Sequences

Field Description
UTR seq + 25 gccuucgacguggcguuuucuucgguuucacuuccggugggaaggauacgagcaagauaaagcagcgagggauuuaagucuggcaacaguuggacugcuggauuuucagagaaguguuccccaaagcaaauuauagugcuaauuuccaATGTCTATTTTCCCTAAGATATCTT
UTR dot + 25 .((((((..((…(((((.(((.((.((.(((((….))))))).))))).)))))…))..))))))…..((((((((….)))))))).((((….))))……………((((……..))))……..((((((……….))))))…
RS 1 seq CUUUAAAAAGCAAUUUUGGAUGUUACGGGAAUUAGGUGUGAAUCCUAGGCUGACCCAGCACCUGUAAAGUGGAUGAAAGCUAACAUCAUUCCAUUGAGAAAAUAUUUCUUGAGAAGGAAUAGUGAGUAAAGUGAAACUAAGCCAGUAGACCGAUCUAAAAAAACAUUGGUAA
RS 1 dot ……………..((.((((..(((..((((.(..(….)..).)))))))))))))…..(((((((((………)))).)))))((((((…))))))…..((..((((…………))))..))…..((((((……….))))))..
RS 2 seq AAUAUUUAAUCCAAGCAAGAGUAACGGAAUCGGGUUAGAGUCCCGAACGGUACGGCCACUGUAAGCCGAGCUUACUCCAUCGGACAGUUGUCCGGUCCAUUGGCGCAAAUGCCGAGAAGGAGGAGAAAAGCGUUGAAGCAAGUCAGGAGACGACUCUUGCAUUAGAUUGGCCC
RS 2 dot ………………(((((..((..((((.(((.(((.(((…….)))..))).))).)))).))))))).(((((((….)))))))((.(((((……)))))…))………((……))….((((((….))))))((……))….
RS 3 seq UCAAGAGAUAGAGGUGGGCCUGACAAGAGUAGAUAAGAUAAGGUAUGAGAGAUAUCGUUGAUUCUUAUUGAAAGGGGAAGGCCCCGAAGGGUGGAUUUUCUCGAAUCUAUGCCUGGUUUCCGGAUUAAGAGUCCUGCGACUGUCACCAAUAUUGGUGGAGAGCUAUCGUUUUG
RS 3 dot ………….(.((((((..(…….(((((((((((((((…..))))).)))..)))))))……)..)))))))…(.((((((((….)))))))).)((((…))))….(.((((….)))).)(((((….))))).(((((….))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table