Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA073859 Similarity: 0.980 Similarity: 0.978 Similarity: 0.978
UTR: 5HSAA073859
Gene: NUB1
MFE: -36.589
ENS: 0.915
Length: 102.
Predicted Ligands:
glycine - 7/20
TPP - 7/20
purine - 3/20
RS: URS0000C44E2D_403957
MFE: -16.814
Ligand: purine
Species: Virgibacillus sp. SK37 Purine riboswitch
RS: URS0000AB4C4E_279238
MFE: -37.568
Ligand: glycine
Species: Novosphingobium aromaticivorans DSM 12444 Glycine riboswitch
RS: URS0000C630A0_1321778
MFE: -18.549
Ligand: glycine
Species: Clostridiales bacterium oral taxon 876 str. F0540 Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA073859 URS0000C44E2D_403957 URS0000AB4C4E_279238 URS0000C630A0_1321778
Length 102. 102. 101. 102.
Similarity - 0.980 0.978 0.978
Ensemble Norm 0.915 - - -
MFE -36.589 -16.814 -37.568 -18.549
Ligands - purine glycine glycine
Gene NUB1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 11. 5.006 3.006
Length SE - 0. 1. 0.
Lev Distance - 23. 26. 28.
UBS 8. 9. 9. 8.
BS 0. 0. 0. 0.
ILL 2. 2. 2. 1.
ILR 1. 0. 1. 1.
H 3. 3. 3. 3.
BL 3. 3. 3. 4.
BR 1. 4. 3. 2.
UN 0.078 0.069 0.158 0.157

Sequences

Field Description
UTR seq + 25 ccggaaugaaaacaaacggcggccgcugccgcauccgggcacucugcuggucgcggcgggaguggcguggcgcagggATGGCACAAAAGAAATATCTTCAAG
UTR dot + 25 ((((.(((……..((((((…)))))))))))))((.((((((..((((((.((….)).))))))))))))…))….((((….))))….
RS 1 seq UAUUGAAGUUUUAUAUGCCGUCGUAUAUCCUCGAUAAUAUGGAUCGAAAGUUUCUACCGGGACACCGUAAAUGUUCUGACUAUGAAGGCAGAUUUCUGUAAA
RS 1 dot ((((((.(….((((((….))))))).)))))).(((((.(((((.((((….(((….))).)))).))).)))))))…((((….))))…
RS 2 seq GCUGAUCGCGCGGGAGAGUUCUCUCGAUUCGUUCAGGAUCGAGAGACGCCGAAGGAGCAACCGCCCCGGAAUCUCUCAGGCAAAUGGACCGCGUUGGUCGA
RS 2 dot .((((.((.(((((((….)))))).).)).))))….((((((..(((..((.((….)))))))..))))))………((((…..))))..
RS 3 seq AUGAAAUUUUCGGGAGAUAAUCUAUUUAUAAGAUAGCCGAAGGAAUAAGCAUGAUAGCCCAUAUUAUGUGAAGCUCUCAGGCAAAAGUACCGGAAAUGGACA
RS 3 dot ……(((((((……..((((((…)))))))))))))…..((.(((.(((.((((…))))..))).))).))….((.(((….))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table