Detected as a riboswitch by 17 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA073880 Similarity: 0.989 Similarity: 0.988 Similarity: 0.987
UTR: 5HSAA073880
Gene: NUBP1
MFE: -11.625
ENS: 0.915
Length: 48.
Predicted Ligands:
SAM - 10/20
preQ_1 - 7/20
unknown - 3/20
 RS: URS0000C3C0C6_1715693
MFE: -14.998
Ligand: SAM
Species: Phaeobacter sp. CECT 7735 SAM/SAH riboswitch
 RS: URS00021EE08A_388739
MFE: -14.042
Ligand: SAM
Species: Roseobacter sp. SK209-2-6 SAM-SAH-Weickhmann-2018 RNA
 RS: URS00021EDA9D_2032623
MFE: -12.106
Ligand: SAM
Species: Paracoccus salipaludis SAM-SAH-Weickhmann-2018 RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA073880 URS0000C3C0C6_1715693 URS00021EE08A_388739 URS00021EDA9D_2032623
Length 48. 49. 47. 49.
Similarity - 0.989 0.988 0.987
Ensemble Norm 0.915 - - -
MFE -11.625 -14.998 -14.042 -12.106
Ligands - SAM SAM SAM
Gene NUBP1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.001 7.023 3.004
Length SE - 1. 1. 1.
Lev Distance - 13. 13. 15.
UBS 4. 4. 4. 5.
BS 0. 0. 0. 0.
ILL 1. 0. 0. 2.
ILR 0. 0. 0. 1.
H 2. 2. 1. 2.
BL 0. 1. 2. 0.
BR 2. 1. 3. 2.
UN 0.125 0.102 0.277 0.061

Sequences

Field Description
UTR seq + 25 acgaaggcggcaaaggcgacggaATGGAGGAGGTGCCTCACGACTGTC
UTR dot + 25 ……((…….))(((((..((((((…..)))).)).)))))
RS 1 seq CUGUCGUCACAACGGCUUCCUGGCGUGACGAUCAAUACCCAGUGGAGCA
RS 1 dot ….(((….)))(((((((((.(((……..))))))).))))).
RS 2 seq CCUGUCACAACGGCUUCCUGGCGUGACGAGGUGACCUCAGUGGAGCA
RS 2 dot …………(((((((((.((.((…)).)).)))).))))).
RS 3 seq CCCCCACAACGGCUUCCUGGCGUGGCGCGGUCUUGAACCCAAUGGAGCG
RS 3 dot …((((..(((….)))..))))(((..(((((….))).)).)))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table