Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA073881 Similarity: 0.978 Similarity: 0.978 Similarity: 0.977
UTR: 5HSAA073881
Gene: NUBP1_0
MFE: -24.841
ENS: 0.961
Length: 103.
Predicted Ligands:
TPP - 8/20
purine - 7/20
SAM - 3/20
 RS: URS0000D96E64_1471761
MFE: -24.394
Ligand: purine
Species: Novibacillus thermophilus Purine riboswitch
 RS: URS0000C7A037_1677858
MFE: -16.099
Ligand: purine
Species: Propionispora sp. 2/2-37 Purine riboswitch
 RS: URS0000BFE97C_1736234
MFE: -20.579
Ligand: purine
Species: Paenibacillus sp. Leaf72 Purine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA073881 URS0000D96E64_1471761 URS0000C7A037_1677858 URS0000BFE97C_1736234
Length 103. 102. 102. 103.
Similarity - 0.978 0.978 0.977
Ensemble Norm 0.961 - - -
MFE -24.841 -24.394 -16.099 -20.579
Ligands - purine purine purine
Gene NUBP1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 9.002 12.025 7.
Length SE - 1. 1. 0.
Lev Distance - 25. 24. 28.
UBS 8. 6. 6. 9.
BS 0. 0. 0. 0.
ILL 3. 1. 1. 3.
ILR 2. 1. 3. 2.
H 3. 3. 2. 2.
BL 1. 1. 2. 3.
BR 2. 2. 1. 3.
UN 0.117 0.157 0.275 0.107

Sequences

Field Description
UTR seq + 25 gagaaucagauugugcccacaaggcggaaauguacgacagcggguuccggugaccacgaaggcggcaaaggcgacggaATGGAGGAGGTGCCTCACGACTGTC
UTR dot + 25 ……….(((((..(((….(((((.(((……)))..))))))))..)))))..((…….))(((((..((((((…..)))).)).)))))
RS 1 seq GCAGAACCUCACAUCACCUGUCAUAUAUUCUCAGAAAUAAGGUCUGAGAGUUUCUACAGGGAGACCGUAAAUCUCCCAACUAUGGCGGGAAACACAGAUUGG
RS 1 dot …………….(((((…..(((((((((…….)))))))))….)))))((((…….))))((((((.((……..)).)).))))
RS 2 seq AUAGCGUAAGUUCAUACUGCUCGUAUAAAUUUGAGGAUAUGGCUCAAAAGUUUCUACCAGGCGACCGUAAAUUACCUGACUACGAGUGAAAUUGUACCUAGG
RS 2 dot ……………..((((.(((.(((((((((…….)))))..)))).)))..))))………..((((..(((((……)))))..))))
RS 3 seq AAAUUAUAAAAGCGUUAUUCUUGUAUAAGCCCAUUAAUAAGGGAUGGGCGUUUCUACAGGCAACCGUGAAUUGCCCCAGGCUACAAGAGACUGAAAGCGACGC
RS 3 dot ………..(.(((…((((((.(((((((((…….))))))).))..)))))).))))(((..((((..(((.((…..)).)))…)))))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table