Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA074167 Similarity: 0.979 Similarity: 0.978 Similarity: 0.978
UTR: 5HSAA074167
Gene: NUDT7
MFE: -26.053
ENS: 0.964
Length: 94.
Predicted Ligands:
TPP - 11/20
glycine - 5/20
SAM - 2/20
 RS: URS0000C605D6_1736316
MFE: -32.647
Ligand: glycine
Species: Pseudorhodoferax sp. Leaf267 Glycine riboswitch
 RS: URS000233461A_525370
MFE: -31.262
Ligand: cobalamin
Species: Rhodococcus equi ATCC 33707 AdoCbl variant RNA
 RS: URS00022DB92F_2845823
MFE: -37.990
Ligand: glycine
Species: Roseomonas sp. CECT 9278 Glycine
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA074167 URS0000C605D6_1736316 URS000233461A_525370 URS00022DB92F_2845823
Length 94. 95. 94. 93.
Similarity - 0.979 0.978 0.978
Ensemble Norm 0.964 - - -
MFE -26.053 -32.647 -31.262 -37.990
Ligands - glycine cobalamin glycine
Gene NUDT7 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10.001 3. 3.
Length SE - 1. 0. 1.
Lev Distance - 23. 29. 28.
UBS 7. 7. 7. 6.
BS 0. 0. 0. 0.
ILL 1. 2. 2. 2.
ILR 1. 3. 2. 1.
H 3. 3. 3. 3.
BL 1. 2. 1. 1.
BR 3. 1. 2. 2.
UN 0.138 0.105 0.117 0.118

Sequences

Field Description
UTR seq + 25 gcucugcgcaagcgcgaccgaccgagcagcuccgaggaguccgcccggaaacaaacauuccccagggcaATGTCACGACTTGGTCTTCCCGAGG
UTR dot + 25 (((((.((..(((((……….)).))).)).)))))..((((((((…….))))…))))……….(((((…..))))).
RS 1 seq UGCGCCCGGUCAGGAGAGAGCCCUUCUUGCAAGGGCCGCCGAAGGCGCAGGACCCAGCCGUCCAAACGCUCAGGCAAAAGGACUGACCCAGGUCG
RS 1 dot …((((.((.(((((……))))).))..)))).(((…((((..((((……))))…))))..)))…..((((……)))).
RS 2 seq AAACGUCUGCGGGGAAGUCCUGUGAGAAUCAGGCGCGGUCCCGCCACUGUGAGGGCGCACGAGGUGCACCCGAAGCCAGAAUGCCGCAACGUUU
RS 2 dot ..(((…((((((..((((((…….)))).))..))))))…)))..(((.((((…)))).)))…….(((((……)))))
RS 3 seq CCUCUGGAAAGCCCGUGGCAUGCGCGCCACGGCACCGACGGAGUAAGGCGAGGGAACGCCCCCGCCGAAUCUCUCAGGUCCAUCCGACAGAGG
RS 3 dot .(((((……(((((((……)))))))……)))))…((((.(((….))).))))……(((..(((…..))).))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table