Detected as a riboswitch by 13 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA074168 Similarity: 0.974 Similarity: 0.973 Similarity: 0.972
UTR: 5HSAA074168
Gene: NUDT7_0
MFE: -38.113
ENS: 0.884
Length: 116.
Predicted Ligands:
molybdenum - 7/20
guanidine - 5/20
TPP - 4/20
RS: URS0000D80FAB_326474
MFE: -37.785
Ligand: Mg2+
Species: Burkholderia sp. LMG 22934 Guanidine-I riboswitch
RS: URS0000C1B2AE_1523418
MFE: -47.987
Ligand: guanidine
Species: alpha proteobacterium AAP38 Guanidine-I riboswitch
RS: URS0000C572D4_1236973
MFE: -32.497
Ligand: guanidine
Species: Bacillus akibai JCM 9157 Guanidine-I riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA074168 URS0000D80FAB_326474 URS0000C1B2AE_1523418 URS0000C572D4_1236973
Length 116. 116. 116. 116.
Similarity - 0.974 0.973 0.972
Ensemble Norm 0.884 - - -
MFE -38.113 -37.785 -47.987 -32.497
Ligands - Mg2+ guanidine guanidine
Gene NUDT7 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.004 5.004 4.006
Length SE - 0. 0. 0.
Lev Distance - 33. 35. 36.
UBS 7. 7. 8. 6.
BS 0. 0. 0. 0.
ILL 2. 1. 2. 1.
ILR 3. 2. 3. 2.
H 3. 3. 3. 3.
BL 0. 2. 2. 1.
BR 0. 1. 0. 0.
UN 0.095 0.155 0.155 0.172

Sequences

Field Description
UTR seq + 25 ggccgcucccaagcccagagcugcucugcgcaagcgcgaccgaccgagcagcuccgaggaguccgcccggaaacaaacauuccccagggcaATGTCACGACTTGGTCTTCCCGAGG
UTR dot + 25 ((..(((((……..(((((((((((((….))))…….)))))))))…)))))))((((((((…….))))…))))……….(((((…..))))).
RS 1 seq GAAAUGGACGACUAGGGUUCCGGUUCGCCGCAUGUCGAAUGCGACGGAUGCUGGUCCGAGAGUUGUCGACCUCAAAGGUGCUCGAGGUUACACGGCGGGAUAAAAGCCCGGGAGAG
RS 1 dot ……(((((((.(((..((((((((.(((((…..))))).)))..))))))))…)))))))((((((……….))))))……((((…….))))……
RS 2 seq AUUAAAGGUGGCUAGGGUUCCGGCCGUGGAUGACACGGGUGUCUGGUCCGAGAGCUGCCGCCAGACACGGCCUAUCGGCCCCGUCUGGUACACGGCGGGACAAAAGCCCGGGAGAU
RS 2 dot ……(((((((.(((..(((((((((…..)))))….)))))))…)))))))(((((((..((((….))))..)))))))……((((.(….)))))……
RS 3 seq GAAAAAGCUUUCUAGGGUUCCGUUAAAUCACUUGUUGAUUUAAGCCUGGUCCGAGAGAGAGCGGUAUAGACGCUUUAAGCGUUUAUACUACACGGAAGGAUAAAAGCCUGGGAGAC
RS 3 dot ……(((((((.(((..(((((((((((…..))))))))…))))))…)))))))((((((((((((…))))))))))))…….(((…….)))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table