Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA074172 Similarity: 0.978 Similarity: 0.978 Similarity: 0.978
UTR: 5HSAA074172
Gene: NUDT7_1
MFE: -20.444
ENS: 0.984
Length: 83.
Predicted Ligands:
zmp-ztp - 6/20
cyclic-di-GMP - 5/20
cobalamin - 2/20
 RS: URS0000C172A8_36847
MFE: -15.788
Ligand: zmp-ztp
Species: Clostridium neopropionicum ZMP/ZTP riboswitch
 RS: URS000232FD40_272129
MFE: -19.482
Ligand: cobalamin
Species: Oscillatoria sp. PCC 6506 AdoCbl variant RNA
 RS: URS0000D81328_1797652
MFE: -18.567
Ligand: fluoride
Species: Chloroflexi bacterium RBG_16_57_8 Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA074172 URS0000C172A8_36847 URS000232FD40_272129 URS0000D81328_1797652
Length 83. 84. 82. 83.
Similarity - 0.978 0.978 0.978
Ensemble Norm 0.984 - - -
MFE -20.444 -15.788 -19.482 -18.567
Ligands - zmp-ztp cobalamin fluoride
Gene NUDT7 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.001 3.002 6.004
Length SE - 1. 1. 0.
Lev Distance - 27. 27. 27.
UBS 8. 7. 8. 7.
BS 0. 0. 0. 0.
ILL 0. 1. 0. 2.
ILR 2. 2. 1. 2.
H 2. 2. 3. 2.
BL 4. 4. 4. 3.
BR 3. 2. 4. 3.
UN 0.036 0.071 0.085 0.096

Sequences

Field Description
UTR seq + 25 gcgcgaccgaccgagcagcuccgaggaguccgcccggaaacaaacauuccccagggcaATGTCACGACTTGGTCTTCCCGAGG
UTR dot + 25 ((.((……)).))..(((.(.((((.((((((((((…….))))…))))………….)).))))).))).
RS 1 seq CAUAGAUUAUAUGACUGACGGAACAGUGGGUGCAACCACGUGAAGUAUAAUCGCUAAAACAAGCCGACCGUCUGGGCAGAAAAA
RS 1 dot ((((…..)))).(((.(((.((.((.(((……..((((…….))))……..))).)).)))))..)))…..
RS 2 seq AUUCUAGAACCUGAAUAUGGGAAAGUCCGGUGUAAUUCCGGCGCUGUGCCGCAACUGUCAAAGCCAGAACGCCAUUGAGGGG
RS 2 dot ((((……..))))..((.(.(((((((…….)))).))).).))….((.((((.((……))..)))).)).
RS 3 seq CUCAUCAUUGGCGAUGAAGCUCGCCCGAGGAUAUUACCAGCUUCCUGAACCGCCCCAACCAGGCUGAUAGCUUCUACUGGCCC
RS 3 dot .(((((……)))))…..(((.(.(((..(((.((((((..((……..))…)))))).)))..))).).)))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table