Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA074329 Similarity: 0.964 Similarity: 0.963 Similarity: 0.962
UTR: 5HSAA074329
Gene: NUP35
MFE: -41.255
ENS: 0.999
Length: 128.
Predicted Ligands:
FMN - 7/20
cobalamin - 5/20
TPP - 3/20
 RS: URS000231F6F5_1435356
MFE: -66.688
Ligand: cobalamin
Species: Rhodococcus pyridinivorans SB3094 Cobalamin riboswitch
 RS: URS0000AB88B5_561180
MFE: -35.684
Ligand: TPP
Species: Bifidobacterium gallicum DSM 20093 TPP riboswitch (THI element)
 RS: URS0000D7DED6_1839754
MFE: -44.223
Ligand: cobalamin
Species: Candidatus Frankia californiensis Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA074329 URS000231F6F5_1435356 URS0000AB88B5_561180 URS0000D7DED6_1839754
Length 128. 129. 126. 127.
Similarity - 0.964 0.963 0.962
Ensemble Norm 0.999 - - -
MFE -41.255 -66.688 -35.684 -44.223
Ligands - cobalamin TPP cobalamin
Gene NUP35 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 13.027 6. 5.003
Length SE - 1. 4. 1.
Lev Distance - 42. 42. 48.
UBS 9. 10. 9. 10.
BS 0. 0. 0. 0.
ILL 3. 3. 3. 4.
ILR 1. 0. 1. 1.
H 3. 2. 2. 2.
BL 2. 5. 3. 3.
BR 4. 5. 6. 3.
UN 0.180 0.016 0.198 0.126

Sequences

Field Description
UTR seq + 25 acgcaaccccauaagguagcacgccguuacccguggggagcguuuccgccauuuuugaaaauuaauugggaagguacugguuuuaaguguaguugccgacgcaATGATGCTGGGTTCACCCACATCTC
UTR dot + 25 ((((..((((((..((((((…..)))))).)))))).))))…………………((((.(..(((((((……….)))).)))..).))))((((.((((….))))))))..
RS 1 seq CGCUGCGGGUGUCCUGCCGAUCCGGUAGGGCACCCGCUGCGUUUUCGGUGAAGCCGGUGAGAUUCCGGCGCUGUCCCGCAACUGUAAGUCCCGAUACGGGGUGAGCCAGGUCGGCCGGCGCGGAGGGUC
RS 1 dot (((.(((((((((((((((…))))))))))))))).)))(((((.((…(((((…….(((((.(((.(.(((..(((((……..))))).))).).))))))))))))))).)))))..
RS 2 seq GGAAUCAAGCAGGGGGGCCUGUGGAGUCAAGCAUUGUGCUUGGUUCAGCAAGCUGAGAUUGGCGUUACGCCUGACCCUUCGAACCUGUUGGUUAGAACCAGUGUAGGGAGCGUUCGCAAUGAAUAU
RS 2 dot .((((((((((.((..((.((……)).)).)).))))))))))……………(((..((((….((((((.((((….)))).))……..)))).)))).)))………
RS 3 seq UGCCAUGUGAUGCCAUGUUGUGCCAUGCUGGGUGGGCGACGGCAGUGGAGGAAGCCGGUGAGAAUCCGGCGCGGUCCCGCCACCGUAACCGGGGAGCGAACCCUCACCGUGUGUCACGGACGUGUAG
RS 3 dot ..((((….((((..(((((.((((…..)))))))))))))))))..((.(((((((((…..((..((.((((………….)))).))..))))))))).)).))…………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table