Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA074556 Similarity: 0.974 Similarity: 0.973 Similarity: 0.973
UTR: 5HSAA074556
Gene: NUSAP1
MFE: -30.570
ENS: 0.999
Length: 112.
Predicted Ligands:
SAM - 6/20
glycine - 5/20
TPP - 3/20
 RS: URS0000C76B49_1664068
MFE: -30.919
Ligand: SAM
Species: bacterium 336/3 SAM riboswitch (S box leader)
 RS: URS0000BE95B3_1353530
MFE: -31.964
Ligand: TPP
Species: Bacteriovorax sp. DB6_IX TPP riboswitch (THI element)
 RS: URS0000C17D21_1736528
MFE: -45.547
Ligand: glycine
Species: Rhizobacter sp. Root404 Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA074556 URS0000C76B49_1664068 URS0000BE95B3_1353530 URS0000C17D21_1736528
Length 112. 112. 112. 112.
Similarity - 0.974 0.973 0.973
Ensemble Norm 0.999 - - -
MFE -30.570 -30.919 -31.964 -45.547
Ligands - SAM TPP glycine
Gene NUSAP1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.004 10.002 1.004
Length SE - 0. 0. 0.
Lev Distance - 34. 32. 36.
UBS 8. 8. 9. 8.
BS 0. 0. 0. 0.
ILL 2. 1. 2. 2.
ILR 2. 1. 1. 2.
H 3. 3. 3. 4.
BL 2. 2. 4. 2.
BR 2. 2. 4. 2.
UN 0.071 0.134 0.116 0.134

Sequences

Field Description
UTR seq + 25 aaaguuaagaguggcgccagggauuugaaccgcgcugacgaaguuuggugauccaucuuccgaguaucgccgggauuucgaaucgcgATGATCATCCCCTCTCTAGAGGAGC
UTR dot + 25 …((((….))))….(((((……((((….((((((((((((((.(.((….))).)))))))).))))))…))))……)))))((((…..)))).
RS 1 seq UACUUAUCCAGAAAGCCUGAGACAUGGGGUCUAUGAAGGCUUGGCAACCGUUCCACCCGCAAGGAAAAUGGUGCCAAAUCCCCCUCAAAACUUGUUUUGAGAAAGAUAAGUG
RS 1 dot ……(((((…..))).))…((((……..((.(((((.((((((((……..)))..)))))))))).))))))…..(((((((((….))))))))).
RS 2 seq UAAAUCCUAAAGGGGUGCUCCUGCGUGGGAGCUGAGACUUUGACUUUGCAUCGAAGGACCCUUUGAACCUGAUUCGGUUAGCACCGACGUAGGGAUUAGGAAGUCAUUUUUU
RS 2 dot …(((((…)))))…(((((((.((.(((((….((((.((.(..((((((….))))))..).)).))))))))).)).)))))))((((….))))…….
RS 3 seq GCGUUCCUCGCUGGAGAGAGGCCCGCCCCGAGCGGGCCCACCGAAGGGGCAAGCGGCGCAUCCGCAAGGGCGUGUCGCCAAUCUCUCAGGUAAAGCGGACAGCCAGGGCAAG
RS 3 dot .(.((((…..)))).).(((((((…..))))))).(((..(((((…(((((((.(((….))).)))))))…)))))..)))…((…..))………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table