Detected as a riboswitch by 5 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA074595 Similarity: 0.887 Similarity: 0.877 Similarity: 0.870
UTR: 5HSAA074595
Gene: NVL
MFE: -48.484
ENS: 0.824
Length: 300.
Predicted Ligands:
cobalamin - 18/20
glucosamine - 1/20
FMN - 1/20
 RS: URS000231DF09_218491
MFE: -84.920
Ligand: cobalamin
Species: Pectobacterium atrosepticum SCRI1043 Cobalamin riboswitch
 RS: URS00023323C3_1317122
MFE: -66.133
Ligand: cobalamin
Species: Aquimarina atlantica Cobalamin riboswitch
 RS: URS0002322B36_555779
MFE: -117.232
Ligand: cobalamin
Species: Desulfonatronospira thiodismutans ASO3-1 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA074595 URS000231DF09_218491 URS00023323C3_1317122 URS0002322B36_555779
Length 300. 301. 302. 298.
Similarity - 0.887 0.877 0.870
Ensemble Norm 0.824 - - -
MFE -48.484 -84.920 -66.133 -117.232
Ligands - cobalamin cobalamin cobalamin
Gene NVL - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 40.001 18.017 38.005
Length SE - 1. 4. 4.
Lev Distance - 130. 150. 149.
UBS 16. 20. 17. 17.
BS 0. 0. 0. 0.
ILL 7. 7. 5. 6.
ILR 8. 8. 6. 4.
H 3. 5. 5. 7.
BL 4. 6. 3. 4.
BR 2. 6. 4. 4.
UN 0.043 0.076 0.172 0.111

Sequences

Field Description
UTR seq + 25 gguccgagcuguggcuugaaagaccgacgcgaugaagcccagaccugcaggguucguggauaauaaacucaagcagcgagucauccaguauagacuauggucgaagaaaaagaaaugcuuuuaggauucagguagaaaaaguauuuagcauaauuaguagugagaaggaacuuaagaauuuaacagaauuagaagaugaacauuuggcaaaaagggcaagacaaggugaagaggauaaugaguauacugaaagcuauucugaugaugauucaaguATGAAGCCCAGACCTGCAGGGTTCG
UTR dot + 25 (((((((((….)))))…))))…((……))…..((((((((..((.(((………(((.((…(((((((((((((((..(.((.(((………….(((((((…..((((((………………………((((……))))………………………))))))….)))))))……………))).)))..)))))))…………..))))))))..)).)))…)))))))))))))…..
RS 1 seq AUUGUAGGAUGAGCGUCCGGCCUUGUAUCACAAGUCAAAAGGGAAUCCAGUGUAAAUCUGGAGCUGACGCGCAGCGGUAAGGAAUGCCCGAGCGAUAGCAUUAUUGCAGACACUGUUAUGUACUCUAAAUAUUUCGAGUUGUAGGACAAAACGUUAACGUUUUGAACAGCGCACAUGCAACUUGAAGUAUGCUGGGUAUCGAUGGGAAGUCAUCGCUUUCGUUGUAUCCCCUACUGUUGUUGACGGUUUGUGGUAACAACGGCAUCCAAGCCCGAAGACCUGCCGGAAUACGUCGCAAUUG
RS 1 dot …((.((((….)))).))(((((…)))))…….((..(((((…….))))).))…..(((((((((.((.((((.((((((((…………(((.(((((..((((((…((((((((((((((((..(((((((….)))))))..)……..)))))))))))))))…)))))).)))))…))))))))..)))..)))).)).))))))))).((((..((.(((((…..(((……)))……..))))).))..))))…….
RS 2 seq ACAUUCGCGCAGAAUUUUGGUUCUGAUACUCCUUGAUCAAGGGAGUUGAAGAUUAAAAGGGAAUCAGGUACAAUGAAAAAUGAAGGUAGAGAUAUGAAUAGCGAUUUUUUAAUUUUUAAUCGUAUUUCUAACAUCUGGCAUCGUAAAUCAAUAUUCCUGAGCUGUUCCCGCAACUGUAUGCUGUGUCCACAUUAAAAAAGGAUGCUUGUUGUUAAUUCUUUAUAACCACUGCUCGUUAUGGCGAUCGGGAAGGUAAACAACAAGACGCGAGCCAGGAGACCUGCCAUUAUUCGAUAUAAUCA
RS 2 dot ………((((((….))))))..(((((((…..)))))))…………((((((((((…..(((…((((((((((((((((((.(((.((((….)))).))).))))))))))…))))….))))…)))…..)))))….)))))……….((((((((………………((((((((…(((((…….(((.((((….)))).))))))))..))))))))))))).)))((((…))))……………….
RS 3 seq UUAAGGACAGUCGUCUCAGGUUUUCCCCAGUCAGGGGAAAUGAAAAGGGAAUCCCGUGUAAAUCGGGAACCGGCCCGCGGCUGUGAGCGGGGACGAAAGCCGCAUUAAGCCACUCUGGACAGAAACAGGGGAAGGCGCGGCAAGCCCAGCACUCACUUCAUUUCUGUUUGUUGCUUAUAAUCAGGUUGUACUGCAAGGAGCCAACCGGUUUAACUGGCAACAAUUAGUACCUGAAGUGAGUGCUGGGCAAGUAGGACGAUCCGCAAGUCAGAAGACCUGCCUGAGACCUUAUUGGACC
RS 3 dot ….((((….))))…..(((((((…..)))))))…….((..(((((…….))))).))..(((((……..)))))…….(((((…..(((.(((((……..)))))…))))))))..(((((((((((((((((…(((.((((((((…((((.(((((..((……)).)))))))))…..)))))))).)))….))))))))))))))))).((((((…….(((.(((….))).)))…….))))))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table