Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA074674 Similarity: 0.975 Similarity: 0.974 Similarity: 0.969
UTR: 5HSAA074674
Gene: NXT2
MFE: -25.522
ENS: 0.984
Length: 118.
Predicted Ligands:
SAM - 7/20
TPP - 4/20
cobalamin - 3/20
 RS: URS0000AB774D_180281
MFE: -43.442
Ligand: TPP
Species: Cyanobium sp. PCC 7001 TPP riboswitch (THI element)
 RS: URS0002319E18_1895809
MFE: -51.340
Ligand: cobalamin
Species: Pseudonocardia sp. 73-21 Cobalamin riboswitch
 RS: URS0000C11D5A_1262808
MFE: -35.889
Ligand: FMN
Species: Clostridium sp. CAG:448 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA074674 URS0000AB774D_180281 URS0002319E18_1895809 URS0000C11D5A_1262808
Length 118. 118. 118. 118.
Similarity - 0.975 0.974 0.969
Ensemble Norm 0.984 - - -
MFE -25.522 -43.442 -51.340 -35.889
Ligands - TPP cobalamin FMN
Gene NXT2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.018 4. 11.
Length SE - 0. 0. 0.
Lev Distance - 32. 33. 38.
UBS 8. 9. 8. 10.
BS 0. 0. 0. 0.
ILL 2. 3. 2. 3.
ILR 3. 4. 5. 4.
H 1. 1. 1. 2.
BL 4. 3. 4. 4.
BR 0. 1. 0. 2.
UN 0.153 0.017 0.153 0.144

Sequences

Field Description
UTR seq + 25 cuuauccuauaggcuacggaauacccugcggaccggacacgugaggagguagugacgccgacacugccagaacacacugcuacaaggucccagATGGATAAAAGAAGACGGGCACTAA
UTR dot + 25 .((((((.((……………(((.(((((((.((.(((….(((((((…….)))))))….)))..))))….))))))))))))))))……………..
RS 1 seq CGGAGUCACUAGGGGUGCCCGUUCAUCGGCCGAUUCGGCAGGUGAUCGAAGGGCUGAGAUCACACCCUCCGAACCUGAUCCGGGUCAUGCCGGCGCAGGGAAGUGAGAACGAACUCCA
RS 1 dot .(((((((((….(((((……..(((.((((((((((((..(((.((((.((……)))))).))))))))..)))))))..))))))))…..)))))…….)))).
RS 2 seq UCCGCGCAGGUUAUGCUCGCUCCGAUCGGCUACGCGGGAACCCGGUGUGACUCCGGGGCGGUCCCGCCACUGUGACCCCGCACGGGGGAGCCAGACCUCGCGUCGCCCGUUGACCAGC
RS 2 dot ..((((.(((((..((((.(((((..(((.(((((((((.(((((…….)))))….))))))….)))…)))..)))))))))..)))))))))…………….
RS 3 seq AUCUAUCUUUGGGGAAGGGUGAAAAUCCCUACCGGCGGUGAUAGCCCGCGAACGCAGAUGCGCCGAACAGGUGAGAUUCCUGUGCCGACGGUUACAGUCCGGAUGGGAAAAGAUCAGA
RS 3 dot …(((((((….)))))))….((((..((((.(.((.(((((..((..(((((((.((((…..))))..))..))))).))..))))))).)))))..))))……….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table