Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA074675 Similarity: 0.912 Similarity: 0.910 Similarity: 0.908
UTR: 5HSAA074675
Gene: NXT2_0
MFE: -60.409
ENS: 0.826
Length: 247.
Predicted Ligands:
cobalamin - 17/20
glucosamine - 1/20
proline - 1/20
 RS: URS0002314DD3_290512
MFE: -79.224
Ligand: cobalamin
Species: Prosthecochloris aestuarii DSM 271 Cobalamin riboswitch
 RS: URS000232913A_281093
MFE: -86.841
Ligand: cobalamin
Species: Chlorobium bathyomarinum Cobalamin riboswitch
 RS: URS000231BE44_290512
MFE: -75.642
Ligand: cobalamin
Species: Prosthecochloris aestuarii DSM 271 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA074675 URS0002314DD3_290512 URS000232913A_281093 URS000231BE44_290512
Length 247. 248. 247. 248.
Similarity - 0.912 0.910 0.908
Ensemble Norm 0.826 - - -
MFE -60.409 -79.224 -86.841 -75.642
Ligands - cobalamin cobalamin cobalamin
Gene NXT2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10.002 19. 13.
Length SE - 1. 0. 1.
Lev Distance - 111. 110. 115.
UBS 15. 15. 15. 17.
BS 0. 0. 0. 0.
ILL 3. 5. 4. 3.
ILR 6. 5. 4. 6.
H 4. 6. 7. 6.
BL 5. 4. 3. 7.
BR 2. 2. 3. 3.
UN 0.085 0.040 0.097 0.073

Sequences

Field Description
UTR seq + 25 cccaggcuugucguuagaaaaguaggggacuuuccuguugaguaucauguuuacaaaagcaaaguggcuuuuaaauuuuaaacuaaguaucaaacaaguagauaagguggaugggagggaucuucaggaacugaagggaaguggaacuuaagcccugcggaccggacacgugaggagguagugacgccgacacugccagaacacacugcuacaaggucccagATGGATAAAAGAAGACGGGCACTAA
UTR dot + 25 (((..((((.((….)).))))..))).((((((((((…((((.(((((((((((((……))))))…………………….))))))).)))))))))))))).(((((((…)))))))…………..((((((.(((((((.((.(((….(((((((…….)))))))….)))..))))….)))))))……………..))))…..
RS 1 seq GUUCUUUCGCUUGUAACUGGUGCCGGUUUAAAAGCCGGAGAAUAGGGAAGUACGUGAGAUUCGUACACUGUACCCGCAACUGUAAUAACGGUAUGCUUCAGUUUAUUCUGUCAUGGCCACAUGACAAUAAAGCUGGAGUUUUUCCUGGUCACUGCGUCGUUGAUUUCCUCCCGGAAAUCCGCGGGAAGGCCCGGAGAGCAGAUGUAACCGUUUAGAGUCAGGAGACCUGCCAGUUUCAAUUGCAUCAU
RS 1 dot (((((((.((((..(((((….)))))…)))).))))))).(((..(((((…….)))))……)))…(((((….)))))..((((((((((….(((((((….)))))))…))))))))))((((((.((((.(((((…..(((((((….))))))))))))…)))).))))))..(((((((………(.((((…)))))………)))))))..
RS 2 seq UUCUUUGUCUUUGUAACUGGUGCCGGUUUAAAAGCCGGAGAAUAGGGAAGUACGUGAGAUUCGUACACUGUACCCGCAACUGUUACAACGGUUUGCUUUCGUUCUGUUCGUCGUGGCCACACGACGCCGGAGCGGAGGUUCUCCAGAGUCACUGCGCUUCGAUUUCCGCCCGGAAAUGCGCGGGAAGGCUCUGAAGAGAUAUUUAUCCGUUGAAAGUCAGGAGACCUGCCAGCUACGAUUUGCUCGA
RS 2 dot (((((((.((((..(((((….)))))..)))).)))))))..(((..(((((…….)))))……)))..((((((….)))))).((((((((((((..(((((((….))))))).))))))))))))(((((((((((.((((((….((((((….))))))))))))…)))))))..))))………………((((…))))(.(((……..))).).
RS 3 seq GUUCUUUCUCUUGUAACUGGUGCCGGUUUAAAAGCCGGAGAAUAGGGAAGUACGUGAGAUUCGUACACUGUACCCGCAACUGUAAUAACGGUAUGCUUCAGUUUAUUCUGUCAUGGCCACAUGACAAUAAAGCUGGAGUUUUUCCUGGUCACUGCGUCGUUGAUUUCCUCCCGGAAAUCCGCGGGAAGGCCCGGAGAGCAGAUGUAACCGUUUAGAGUCAGGAGACCUGCCACGUUAUUAUUUCUAUG
RS 3 dot …..((((((.(((((((….)))))…..)).))))))..(((..(((((…….)))))……)))…(((((….)))))..((((((((((….(((((((….)))))))…)))))))))).(((((.((((.(((((…..(((((((….))))))))))))…)))).)))))..(((.((((.(((.(((.(((….))))))..)))…)))).)))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table