Detected as a riboswitch by 14 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA074766 Similarity: 0.984 Similarity: 0.984 Similarity: 0.984
UTR: 5HSAA074766
Gene: OCEL1_0
MFE: -23.718
ENS: 0.874
Length: 69.
Predicted Ligands:
fluoride - 12/20
cobalamin - 5/20
homocysteine - 2/20
 RS: URS0000DA28DF_1797900
MFE: -17.351
Ligand: fluoride
Species: Deltaproteobacteria bacterium RIFOXYB2_FULL_66_7 Fluoride riboswitch
 RS: URS0000BF1A08_1574623
MFE: -13.967
Ligand: glutamine
Species: Lyngbya confervoides BDU141951 Glutamine riboswitch
 RS: URS0000D7D6FE_658167
MFE: -16.088
Ligand: fluoride
Species: Alcaligenaceae bacterium BZ59 Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA074766 URS0000DA28DF_1797900 URS0000BF1A08_1574623 URS0000D7D6FE_658167
Length 69. 69. 68. 69.
Similarity - 0.984 0.984 0.984
Ensemble Norm 0.874 - - -
MFE -23.718 -17.351 -13.967 -16.088
Ligands - fluoride glutamine fluoride
Gene OCEL1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.008 4.032 2.021
Length SE - 0. 1. 0.
Lev Distance - 19. 19. 21.
UBS 6. 6. 5. 5.
BS 0. 0. 0. 0.
ILL 0. 1. 0. 0.
ILR 1. 0. 0. 0.
H 2. 2. 2. 2.
BL 3. 2. 2. 3.
BR 2. 4. 3. 2.
UN 0.130 0.217 0.309 0.275

Sequences

Field Description
UTR seq + 25 agcccugcugagcgaccccgccagucggguccauccugcaguaaATGCACAACCCGGACGGAAGTGCCT
UTR dot + 25 ..(((.((((.(((….))))))).)))(((.(((((((…..))))……))).)))…….
RS 1 seq CGUGAACCCGGCGAUGGAGUUCGCCGUGAACCGCCUAUGUCGAUAGAGGCUGAUGACUCCUACCCUACA
RS 1 dot .(((((((((….))).))))))(((.(.((..((((….)))).)).).)))…………..
RS 2 seq AUCGUUCAUCCGACCAGCGCAUCUGGACAGGACGGAAGUAAGAGAUAUCUUCUCUGAAGGAACGCGCC
RS 2 dot ….(((.((((.((((…..)))).).))).)))….(((((…..)))))………….
RS 3 seq UUCAGAUACGGAGAUGGCAUACCUCCUAUCCCAACCGCUGGAUUCCCAGCUGAUGAUGCCUACGAAUUU
RS 3 dot ….((((.((((………)))))))).((.(.(((((….))))).).))…………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table