Detected as a riboswitch by 3 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA074767 Similarity: 0.990 Similarity: 0.990 Similarity: 0.990
UTR: 5HSAA074767
Gene: OCEL1_1
MFE: -11.
ENS: 0.761
Length: 47.
Predicted Ligands:
SAM - 18/20
preQ_1 - 2/20

 RS: URS0000C8A6C7_574376
MFE: -5.666
Ligand: preQ_1
Species: Bacillus sp. BL4-6 PreQ1 riboswitch
 RS: URS0000C39A44_561184
MFE: -15.542
Ligand: SAM
Species: Antarctobacter sp. JLT354-W SAM/SAH riboswitch
 RS: URS0000AB6F73_408172
MFE: -13.392
Ligand: SAM
Species: marine metagenome SAM/SAH riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA074767 URS0000C8A6C7_574376 URS0000C39A44_561184 URS0000AB6F73_408172
Length 47. 46. 47. 47.
Similarity - 0.990 0.990 0.990
Ensemble Norm 0.761 - - -
MFE -11. -5.666 -15.542 -13.392
Ligands - preQ_1 SAM SAM
Gene OCEL1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.018 0.004 0.011
Length SE - 1. 0. 0.
Lev Distance - 11. 13. 14.
UBS 3. 2. 3. 3.
BS 0. 0. 0. 0.
ILL 1. 0. 1. 1.
ILR 1. 0. 1. 1.
H 1. 1. 1. 1.
BL 0. 0. 0. 0.
BR 1. 1. 1. 1.
UN 0.234 0.370 0.298 0.340

Sequences

Field Description
UTR seq + 25 agucggguccauccugcaguaaATGCACAACCCGGACGGAAGTGCCT
UTR dot + 25 .(((((((……((((…..))))..)))).)))……….
RS 1 seq UAUUUCGUGGUUCGAAACCAUCCCACGUAAAAAAAACUAAGGAGAU
RS 1 dot ..((((((((…………))))).)))……………
RS 2 seq AACCCGUCACAACGGCUUCCUGGCGUGACGGCGUCAUCAAUGGAGCA
RS 2 dot .(((((((((..(((….)))..))))))).))………….
RS 3 seq CCGUAGCUGCAACGGCUUCCUGGCGCAGCUUACAUUUUAUUGGAGCA
RS 3 dot ..((((((((..(((….)))..)))))).))…………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table