Detected as a riboswitch by 18 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA074860 Similarity: 0.989 Similarity: 0.988 Similarity: 0.988
UTR: 5HSAA074860
Gene: ODAM
MFE: -2.449
ENS: 0.926
Length: 42.
Predicted Ligands:
SAM - 14/20
preQ_1 - 5/20
glutamine - 1/20
 RS: URS0000C32C8D_666686
MFE: -5.142
Ligand: preQ_1
Species: Bacillus sp. 1NLA3E PreQ1 riboswitch
 RS: URS0000C866FA_1565991
MFE: -7.631
Ligand: preQ_1
Species: Bacillus sp. X1(2014) PreQ1 riboswitch
 RS: URS00021EDD2E_12908
MFE: -6.177
Ligand: SAM
Species: unclassified sequences SAM-SAH-Weickhmann-2018 RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA074860 URS0000C32C8D_666686 URS0000C866FA_1565991 URS00021EDD2E_12908
Length 42. 43. 43. 43.
Similarity - 0.989 0.988 0.988
Ensemble Norm 0.926 - - -
MFE -2.449 -5.142 -7.631 -6.177
Ligands - preQ_1 preQ_1 SAM
Gene ODAM - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.011 2.004 3.004
Length SE - 1. 1. 1.
Lev Distance - 13. 14. 14.
UBS 2. 1. 2. 2.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 1.
ILR 0. 0. 0. 1.
H 2. 1. 1. 1.
BL 0. 0. 1. 0.
BR 0. 0. 0. 0.
UN 0.429 0.535 0.488 0.488

Sequences

Field Description
UTR seq + 25 agauauaucauacgaaaATGAAAATTATAATTCTTCTTGGAT
UTR dot + 25 …….((((……))))……….(((….))).
RS 1 seq UAUAAAGAGGUUCUAGCUACCCUCUCAAAAAAACUAAGGAAAA
RS 1 dot …..(((((……….)))))………………
RS 2 seq GCGGGAGAGGUUCUAGCUACCCUCUAUAAAAAACUAAGGAAAA
RS 2 dot …((((.(((…….)))))))………………
RS 3 seq AUCUGCAACGGCUUCCUGAAGCAGUUAACAAUUAAUUGGAGCG
RS 3 dot ..((((..(((….)))..))))……………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table