Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA074861 Similarity: 0.991 Similarity: 0.990 Similarity: 0.990
UTR: 5HSAA074861
Gene: ODAM_0
MFE: -2.449
ENS: 0.955
Length: 44.
Predicted Ligands:
preQ_1 - 15/20
SAM - 4/20
glutamine - 1/20
 RS: URS0000D6827E_12908
MFE: -5.592
Ligand: glutamine
Species: unclassified sequences Glutamine riboswitch
 RS: URS0000C2252C_1261130
MFE: -4.387
Ligand: preQ_1
Species: Wohlfahrtiimonas chitiniclastica SH04 PreQ1 riboswitch
 RS: URS0000C15779_1423744
MFE: -5.430
Ligand: preQ_1
Species: Lactobacillus floricola DSM 23037 = JCM 16512 PreQ1 riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA074861 URS0000D6827E_12908 URS0000C2252C_1261130 URS0000C15779_1423744
Length 44. 44. 45. 45.
Similarity - 0.991 0.990 0.990
Ensemble Norm 0.955 - - -
MFE -2.449 -5.592 -4.387 -5.430
Ligands - glutamine preQ_1 preQ_1
Gene ODAM - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.008 0.027 0.065
Length SE - 0. 1. 1.
Lev Distance - 12. 12. 12.
UBS 2. 2. 2. 2.
BS 0. 0. 0. 0.
ILL 0. 1. 0. 0.
ILR 0. 0. 0. 0.
H 2. 1. 2. 2.
BL 0. 0. 0. 0.
BR 0. 1. 0. 0.
UN 0.455 0.545 0.289 0.

Sequences

Field Description
UTR seq + 25 cuagauauaucauacgaaaATGAAAATTATAATTCTTCTTGGAT
UTR dot + 25 ………((((……))))……….(((….))).
RS 1 seq AUCGUUCAACCCAUACGGGUCGCAAGUAAGUCACGGAACGGAGC
RS 1 dot …((…((((….)))).))…………………
RS 2 seq UUUCCCGUGGUUCGCAAUCCUCCCACACAAAAAAACUAAGGAGUU
RS 2 dot ……((((…………))))…….((((….))))
RS 3 seq AAUUUUGUGGUUCGAAACCAUCCCACAUAAAAAAACUAGGAGUGA
RS 3 dot ……((((((…))))))..(((……………))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table