Detected as a riboswitch by 3 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA074937 Similarity: 0.986 Similarity: 0.984 Similarity: 0.984
UTR: 5HSAA074937
Gene: OFD1
MFE: -7.110
ENS: 0.798
Length: 57.
Predicted Ligands:
unknown - 17/20
purine - 1/20
cobalamin - 1/20
 RS: URS0000C79845_1263000
MFE: -12.796
Ligand: purine
Species: Firmicutes bacterium CAG:110 Purine riboswitch
 RS: URS0000D66C95_12908
MFE: -17.327
Ligand: unknown
Species: unclassified sequences nhaA-I RNA
 RS: URS0000ABA1D9_550540
MFE: -20.366
Ligand: cobalamin
Species: Ferrimonas balearica DSM 9799 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA074937 URS0000C79845_1263000 URS0000D66C95_12908 URS0000ABA1D9_550540
Length 57. 57. 56. 57.
Similarity - 0.986 0.984 0.984
Ensemble Norm 0.798 - - -
MFE -7.110 -12.796 -17.327 -20.366
Ligands - purine unknown cobalamin
Gene OFD1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.008 1.059 5.
Length SE - 0. 1. 0.
Lev Distance - 19. 20. 20.
UBS 3. 2. 3. 4.
BS 0. 0. 0. 0.
ILL 0. 0. 1. 0.
ILR 1. 0. 1. 0.
H 2. 2. 2. 3.
BL 0. 0. 0. 1.
BR 0. 0. 0. 1.
UN 0.421 0.333 0.179 0.105

Sequences

Field Description
UTR seq + 25 guguucguuaaacuuucgccgcuaggccucuuATGCATTTTTTAAAAGAATTGGCAG
UTR dot + 25 ……………..(((….)))……(((((((((…))))))..))).
RS 1 seq GUAUAAGCUCAUAAUAUGGUUGAGCGUCUCUACCAACCGCCGUAAAUGGUUGACUGC
RS 1 dot ……(((((………)))))……..((((((…….))))))…..
RS 2 seq GGGUGUCACGCUGCAUUCCGCAGACGACAGGACUAACGUUGGUCGGGCCGCCAACG
RS 2 dot …((((…((((…..))))..))))…….(((((((……)))))))
RS 3 seq UCCGGUGAGAAUCCGGAGCUGGCGCGCAACGGUAUGAGGCCCACGCCUUAAGCCCGA
RS 3 dot (((((…….)))))((……))…(((.((((((….)))))).)))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table