Detected as a riboswitch by 12 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA075086 Similarity: 0.977 Similarity: 0.974 Similarity: 0.973
UTR: 5HSAA075086
Gene: OMA1
MFE: -35.848
ENS: 0.882
Length: 113.
Predicted Ligands:
TPP - 14/20
guanidine - 4/20
methionine - 1/20
 RS: URS0000BEB43A_1736354
MFE: -56.275
Ligand: methionine
Species: Geodermatophilus sp. Leaf369 S-adenosyl methionine (SAM) riboswitch,
 RS: URS0000D82390_1972445
MFE: -33.943
Ligand: TPP
Species: Desulfobacteraceae bacterium 4572_89 TPP riboswitch (THI element)
 RS: URS0000C5EE50_984487
MFE: -26.793
Ligand: TPP
Species: Candida tanzawaensis NRRL Y-17324 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA075086 URS0000BEB43A_1736354 URS0000D82390_1972445 URS0000C5EE50_984487
Length 113. 113. 111. 112.
Similarity - 0.977 0.974 0.973
Ensemble Norm 0.882 - - -
MFE -35.848 -56.275 -33.943 -26.793
Ligands - methionine TPP TPP
Gene OMA1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.001 18. 4.001
Length SE - 0. 4. 1.
Lev Distance - 30. 22. 33.
UBS 9. 8. 10. 8.
BS 0. 0. 0. 1.
ILL 1. 1. 1. 2.
ILR 4. 5. 2. 4.
H 2. 2. 2. 2.
BL 2. 1. 4. 1.
BR 2. 1. 5. 2.
UN 0.035 0.009 0.018 0.071

Sequences

Field Description
UTR seq + 25 cgggcaggaagugcgggugcgcgccugcgcauaggucgggucugcggugucaccgcuuucgcuucugcuugaguaaucaagugaaaaaATGAGCTTCATCTGTGGATTGCAGT
UTR dot + 25 ((((((.(((((((((..((((((((((……).)))))…..))))..))))….))))))))))).((((((.((((((………)))).))…))))))…
RS 1 seq GGUCACGAGUGCCAGCGCGAAGCCCCGGCUCGCUGGCCGGCAACCCUUCCACCGCGACGGGGUGCUCCGGGUGACGACCUGGCGGCUGCGCAGCGCAGCCGCAAGCGCGGGUC
RS 1 dot .((((((((((((.((((((((..((((((….))))))…..))))….))).)..)))))))…)))))(((((((((((((((…)))))))))…..))))))
RS 2 seq GUGGUAGGCUGGGGGAGCCGAUGGCAUCGGCUGAGAGGAGACUGAACUAUGUCUCGACUCCUGGAACCUGCUCCAGAUAAUUCUGGCGAAGGAAAGUCAAGAUUUAUUUUC
RS 2 dot (.((((((….(((((.(((.((((((((((……)).))))….))))))).)))))….)))))).)((((((.((((((……..)))).)).))))))..
RS 3 seq GUGUUAACUUACGGGUGUCUUUCUGCUUCUUCUUAGAAGCUCAAAGUCUGAGAUUAUACCGUACGGACUCGAUCAAGUUGAAACUUGCGUGAGGAUAGUUAGCACAAAAUAU
RS 3 dot (((((((((((((((((((((.((((((((….))))))….))…))))).)).))))).(..((((..(((((….)))))..))))..))))))))))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table