Detected as a riboswitch by 17 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA075089 Similarity: 0.970 Similarity: 0.970 Similarity: 0.970
UTR: 5HSAA075089
Gene: OMA1_0
MFE: -50.566
ENS: 0.926
Length: 136.
Predicted Ligands:
molybdenum - 17/20
TPP - 2/20
FMN - 1/20
 RS: URS0000AB6238_264732
MFE: -56.198
Ligand: molybdenum
Species: Moorella thermoacetica ATCC 39073 Moco (molybdenum cofactor) riboswitch
 RS: URS0000ABBA61_796620
MFE: -36.347
Ligand: molybdenum
Species: Vibrio caribbenthicus ATCC BAA-2122 Moco (molybdenum cofactor) riboswitch
 RS: URS0000C3D48F_294935
MFE: -37.578
Ligand: molybdenum
Species: Enterovibrio coralii Moco (molybdenum cofactor) riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA075089 URS0000AB6238_264732 URS0000ABBA61_796620 URS0000C3D48F_294935
Length 136. 136. 136. 136.
Similarity - 0.970 0.970 0.970
Ensemble Norm 0.926 - - -
MFE -50.566 -56.198 -36.347 -37.578
Ligands - molybdenum molybdenum molybdenum
Gene OMA1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.001 7.001 7.011
Length SE - 0. 0. 0.
Lev Distance - 38. 38. 38.
UBS 9. 9. 9. 8.
BS 0. 0. 0. 0.
ILL 2. 2. 1. 1.
ILR 1. 2. 0. 1.
H 5. 5. 5. 5.
BL 0. 2. 2. 2.
BR 1. 2. 2. 2.
UN 0.110 0.147 0.147 0.213

Sequences

Field Description
UTR seq + 25 gaagggcgccccggccgguauggcgggcaggaagugcgggugcgcgccugcgcauaggucgggucugcggugucaccgcuuucgcuucugcuugaguagucaagugaaaaaATGAGCTTCATCTGTGGATTGCAGT
UTR dot + 25 ………(((((((..((((((((((…..((((….)))))))))).)))))))))))…(((((…)))))((((((((((((….))))..))))))))..((((…))))((((…..)))).
RS 1 seq UUGAAUAGUCAUCUCCGAGCCGGUGCUCCUAAGGGCUGUCGCCUAUGGAACACCGGCCUGGGUUUCGUACCCAUGGGGUAGGUCGGGAAACGGGCCUGCCUCCCUUUGCUCGGAAAGGAGAUUCCCCAUGGCUUCU
RS 1 dot ………………(((((((.(((…((((….))))..))).))))))).(((((…..))))).((((((((((.(….).))))))))))(((((……)))))(((..((….))..)))
RS 2 seq UAAUCGCCAUAACUCCGAAUUCUAUCGACUAAGUUCAUGAGAAUAUGUGUCUAGAAUCAGUGACAAACUGUCACGAAGGCAUGGUUGGAAAUGACCAUGCCUCCUGUGUUUGGAAAGGUGUUGAAUGGCACAACAA
RS 2 dot …………….(.((((((..(((((.((((….)))).)).)))))))))).((((((…))))))..(((((((((((….)))))))))))(((……….)))(((((…….))))).
RS 3 seq GCGCAUUAGUAACUCCGAAGCCUAUUUCGCUAAGUUCGAAAGAAUACGGGAAAUAGGCCGUGACAUUCCGUCACCAGGGCGCUCAUAGAAAUGUGGUCGUCUCCCGUAUUUGGAAAGGUGUUUCGUGGCAACGCAA
RS 3 dot ……………….(((((((((.(…((((….))))..).))))))))).(((((…..)))))..(((((.(((((….))))).))))).(((….)))….(((((…….)))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table