Detected as a riboswitch by 14 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA075090 Similarity: 0.973 Similarity: 0.973 Similarity: 0.973
UTR: 5HSAA075090
Gene: OMA1_1
MFE: -33.997
ENS: 0.896
Length: 110.
Predicted Ligands:
SAM - 10/20
Mn2+ - 6/20
TPP - 2/20
 RS: URS0000C4D2D9_1395513
MFE: -32.128
Ligand: SAM
Species: Sporolactobacillus laevolacticus DSM 442 SAM riboswitch (S box leader)
 RS: URS0000D85021_1906741
MFE: -47.219
Ligand: Mn2+
Species: Jeongeupia sp. USM3 yybP-ykoY manganese riboswitch
 RS: URS0000BFB9A1_1397528
MFE: -38.808
Ligand: TPP
Species: Halomonas sp. PBN3 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA075090 URS0000C4D2D9_1395513 URS0000D85021_1906741 URS0000BFB9A1_1397528
Length 110. 109. 110. 110.
Similarity - 0.973 0.973 0.973
Ensemble Norm 0.896 - - -
MFE -33.997 -32.128 -47.219 -38.808
Ligands - SAM Mn2+ TPP
Gene OMA1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 9.014 4.003 7.005
Length SE - 1. 0. 0.
Lev Distance - 32. 35. 34.
UBS 7. 8. 7. 8.
BS 0. 0. 0. 0.
ILL 0. 1. 1. 1.
ILR 1. 3. 0. 3.
H 5. 4. 4. 4.
BL 0. 1. 1. 0.
BR 1. 0. 1. 1.
UN 0.127 0.009 0.073 0.055

Sequences

Field Description
UTR seq + 25 gugcgcgccugcgcauaggucgggucugcggugucaccgcuuucgcuucugcuugagucaguccucacgguagucaagugaaaaaATGAGCTTCATCTGTGGATTGCAGT
UTR dot + 25 ((((((….))))))………..(((((…)))))(((((((((((((((((……)))).)))))..))))))))..((((…))))((((…..)))).
RS 1 seq CUCUUAUCGCGAGAGACGGAGGGAAUUGGCCCGAUGAAGUCCGGCAACCACUUUACGUUCAGUAAAGUACAGGUGCCAAAUCCAACAGGACUUUCCUGAAAGAUAAGGA
RS 1 dot (((((…..))))).((..(((……)))..))(((((((((.((((((((((…..)))))))…))))))……….))))))((((……..))))
RS 2 seq UCUUUGGUCUUCAGGGGAGUAGUCGCCUGCCGCGUGCAGGGGGUACGUCAACACACUUGAGCCCGUGGCUCAUGGCGUAUCCGGCCGGUUGCCUGCCUUGGCACCGUGCU
RS 2 dot ((((((…..))))))……..(((((…..)))))((((((((((…….((((((…))))))))))))))))((((((.((((……))))))).)))
RS 3 seq ACUCGCUUGACGGGGUGCCGUUACCGACGGCUGAGAUCAUGCGCCCAAGCAUGGAUCCCGUUGAACCUGAACUGGCUAGGACCAGCGUAGGGAUCAAGCGACACGCCGCC
RS 3 dot .((((((((((((….))))))…..))).)))..(((((……)))))((((((((((..((((…….))))..))))…))))))..(((……))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table