Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA075094 Similarity: 0.974 Similarity: 0.970 Similarity: 0.968
UTR: 5HSAA075094
Gene: OMA1_2
MFE: -15.422
ENS: 0.976
Length: 116.
Predicted Ligands:
SAM - 12/20
molybdenum - 2/20
FMN - 2/20
 RS: URS0000D8F36B_1797457
MFE: -29.282
Ligand: SAM
Species: Candidatus Beckwithbacteria bacterium RBG_13_42_9 SAM riboswitch (S box leader)
 RS: URS0000C843B7_690567
MFE: -29.703
Ligand: molybdenum
Species: Syntrophomonas zehnderi OL-4 Moco (molybdenum cofactor) riboswitch
 RS: URS0000741A82_1462526
MFE: -23.122
Ligand: SAM
Species: Virgibacillus massiliensis SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA075094 URS0000D8F36B_1797457 URS0000C843B7_690567 URS0000741A82_1462526
Length 116. 116. 118. 119.
Similarity - 0.974 0.970 0.968
Ensemble Norm 0.976 - - -
MFE -15.422 -29.282 -29.703 -23.122
Ligands - SAM molybdenum SAM
Gene OMA1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.017 2.002 6.
Length SE - 0. 4. 9.
Lev Distance - 34. 35. 29.
UBS 8. 8. 7. 8.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 0.
ILR 0. 1. 0. 2.
H 4. 3. 4. 3.
BL 4. 3. 3. 5.
BR 2. 3. 2. 2.
UN 0.147 0.276 0.195 0.134

Sequences

Field Description
UTR seq + 25 auaguugccugaguggagguuuaaaaaaguaauaauacaucccguagaaauuugaacugcacagaaauauauaagguagucaagugaaaaaATGAGCTTCATCTGTGGATTGCAGT
UTR dot + 25 ……..(((.(.(((.((…………….)).)))).)))..(((((.(((((……………))))))))))……((((…))))((((…..)))).
RS 1 seq AAAUUAUCAAGAGAGUCGCGAGGGAAUGGGCCCGUUAAAGCGACCGACAACCGAUCCUGAGCUUAAGUCGAAGGAUACGGUGCCAAAUCCCACCCAAAUGGAGGGAAAGAUAAGCC
RS 1 dot …………(.((((((.(((……))).)….))))))….(((((((((………….))))).))))……((((.((…..)).))))……….
RS 2 seq AUAGUCUUCAGUCUCCGAGUCUUAAGACCUAAAGCUUAAACCAUGGUUUUACGACCGAUAGGGUGCAACUGGAAACGGUUACGCCUCCCAUGCGGAAAGGAGCGAGCUGUAAAGGCUU
RS 2 dot ……………((.(((.(((((((……………))))))).)))))…(((((.(((((….))))).)))))…..((……..))(((((…..)))))
RS 3 seq AACCUAUCAAGAGUCAGGGGAGGAAACUGGUCCAUUGAUCCUGCGGCAACCAUACUCUAUUUGUUAUUCCGAGUAAAGGUGCUAAAUCCAGCAAACGAAACUUGUUUGAAAGAUGGGAA
RS 3 dot ………((.(((((.(((………))).))))).))..(((.(((.(((((………….)))))..))))))…((((.(((((((…)))))))…..))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table