Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA075206 Similarity: 0.947 Similarity: 0.942 Similarity: 0.940
UTR: 5HSAA075206
Gene: OPTN
MFE: -50.127
ENS: 0.907
Length: 196.
Predicted Ligands:
cobalamin - 19/20
glucosamine - 1/20

 RS: URS0000BE3E8D_1818881
MFE: -78.927
Ligand: cobalamin
Species: Candidatus Thiodiazotropha endoloripes Cobalamin riboswitch
 RS: URS000232AD76_1080227
MFE: -47.598
Ligand: cobalamin
Species: Enterovibrio sp. sw014 Cobalamin riboswitch
 RS: URS00023293A0_1612624
MFE: -70.248
Ligand: cobalamin
Species: Pararhizobium polonicum Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA075206 URS0000BE3E8D_1818881 URS000232AD76_1080227 URS00023293A0_1612624
Length 196. 195. 196. 196.
Similarity - 0.947 0.942 0.940
Ensemble Norm 0.907 - - -
MFE -50.127 -78.927 -47.598 -70.248
Ligands - cobalamin cobalamin cobalamin
Gene OPTN - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 23. 18.005 7.
Length SE - 1. 0. 0.
Lev Distance - 58. 70. 77.
UBS 12. 15. 13. 13.
BS 0. 0. 0. 0.
ILL 1. 2. 1. 2.
ILR 1. 3. 4. 3.
H 7. 7. 5. 7.
BL 3. 6. 5. 3.
BR 3. 3. 3. 2.
UN 0.128 0.123 0.056 0.143

Sequences

Field Description
UTR seq + 25 uccagccuccacuacgggaucugcgggaagacacggggaagacgaacuccgcacacugcauuugauuaaugauuuauuuugauuaacgccgucacagugacgccuuagagcagucccuguucacccgggucccagccucgaccccgcacggacagcgagggaacuucugcaATGTCCCATCAACCTCTCAGCTGCC
UTR dot + 25 (((.((.(((……)))…)).)))…..(((((……..)))))……((..((((((((………)))))))).))(((((…)))))…..((((((…))))))….(((((……..)))))…..((.(((((((((…………………..))))).))))))
RS 1 seq AGGUGCCUGCCCGAGAGGGCGGCUCAACCUUGGGGGGUGAACUCCGCCCAAGGGGAAACGGGAAGCAGGUGUAAGACCUGCGCUGCCCCCGCAACGGUAAGUAGAGUGUGACAUCGCAACAGCCACUGUGCAGAGCGCAUGGGAAGGCGCCGAUGUCCGGUGAAACCACCAAUCUGCAAGCCCGGAUACCGGCCU
RS 1 dot ..(.(((.((((….))))))).)..(((((((.((……)).)))))))……(((..((((((…..))))))….)))(((…)))………((((….))))…(((.((((((…..))))))…)))((((.(((((((.(….((……))….)))))))).))))..
RS 2 seq UAAUUAUAUGAUGUGACUCGUAUAAUCUGUCGUUCUUUCAUCAGCUGGGAAUCCGGUGAGACUCCGGAACUGACGCGCAGCGGUAAGAGGAAACGAAAGUAGCAGGGUUAAGAGCCAGACACUGCAGAAUUCUGUGGGAAGUCGCUGCCGUAGGCUGUCCUUAAGUCCGAAUAUCAGCUGGUAUAACAAUAUGGUA
RS 2 dot ..(((((((((……)))))))))((.(((((((((.(((.((((.(..(((((…….)))))…….).))))))).)))))..)))).))……((((…)))).(((.((((((….))))))…)))..((((((((((((……………..)))))……….)))))))
RS 3 seq UCUGUUCGUGAUGUUCAGGGUGCCAUGUCGACAGUGAAGGAUAUGGAUAAUUGGGAAGCCGGUGCGAUGCCGGCGCUGCCCCCGCAACGGUAGCGGAACUGCAAAUCUCGACGGACAUCAUCGGGGGAGAAUACCCCGGGAAGGUCCGAAAGGAUGGUUCCGAAGUCCGGAAACCAGCCUUGAACGGAAUAACCCG
RS 3 dot ((((..(…..)..))))…(((((((……….)))))))……(((..((((((…..))))))….)))((((…….))))……………(((((.((.((((((…….))))))))..))))).((((.((((((((…..))))).))).))))…(((……)))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table