Detected as a riboswitch by 12 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA075325 Similarity: 0.982 Similarity: 0.981 Similarity: 0.981
UTR: 5HSAA075325
Gene: ORMDL1
MFE: -27.238
ENS: 0.876
Length: 90.
Predicted Ligands:
glycine - 8/20
GMP - 5/20
zmp-ztp - 2/20
 RS: URS0000C4E2AC_1666914
MFE: -31.376
Ligand: glycine
Species: Rhodobacteraceae bacterium HLUCCO07 Glycine riboswitch
 RS: URS0000C0EF41_891968
MFE: -21.584
Ligand: cyclic-di-GMP
Species: Acetomicrobium mobile DSM 13181 Cyclic di-GMP-II riboswitch
 RS: URS0000C7CEA7_69279
MFE: -35.199
Ligand: cobalamin
Species: Aquamicrobium defluvii AdoCbl riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA075325 URS0000C4E2AC_1666914 URS0000C0EF41_891968 URS0000C7CEA7_69279
Length 90. 89. 90. 91.
Similarity - 0.982 0.981 0.981
Ensemble Norm 0.876 - - -
MFE -27.238 -31.376 -21.584 -35.199
Ligands - glycine cyclic-di-GMP cobalamin
Gene ORMDL1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4. 6.004 9.001
Length SE - 1. 0. 1.
Lev Distance - 21. 23. 21.
UBS 9. 10. 10. 8.
BS 0. 0. 0. 0.
ILL 2. 3. 2. 2.
ILR 4. 3. 5. 2.
H 1. 1. 1. 1.
BL 6. 6. 6. 4.
BR 2. 3. 4. 2.
UN 0.044 0.056 0.111 0.011

Sequences

Field Description
UTR seq + 25 guggggcggcggguaagugggcacgaacgcgguggacgcuguacagucgccuucgucgagcaaacATGAACGTTGGAGTTGCCCACAGTG
UTR dot + 25 (((((.(((((..((.((..((.((.(((.(((.(((……..))))))..))))).))..)).))..)))))……)))))….
RS 1 seq AACACCGAGCCGGGAGAACCGUCAUGCAGACGGUGCCGAAGGAGCAACCGCCCCGGAAACUCUCAGGCCAAAGGGACCGGCCGGUGACA
RS 1 dot ..(((((.(((((…..((.(…((.((.(((.(((..((.((….)))))))..))).))..))…).)).))))))))))…
RS 2 seq AGGUUAUGGGGAAACGAUGAACCCCUCGCAUUUCCGAAAACGGGCGCAAGAGCGAAGGGUGAGUGAGUAGCGCGACCGGCCCCUUGGAGU
RS 2 dot .((((.(.(.(..((.((..((((.((((.((((((….))))….)).)))).))))..))..))..).).)..))))………
RS 3 seq GGUUACGGAUCUGGAAGCUGGUGAAAAUCCAGCACGGUCGCGCCACUGUGACCCGCGGUUAUCGCCGGAAGUCAGGCCUUGGUCCGUGCCC
RS 3 dot ((.(((((((((((…(((((((.((.((.((..((((((……)))))).)))))).)))))))…))))……))))))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table