Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA075339-0 Similarity: 0.982 Similarity: 0.981 Similarity: 0.981
UTR: 5HSAA075339-0
Gene: OS9
MFE: -30.979
ENS: 0.985
Length: 84.
Predicted Ligands:
zmp-ztp - 11/20
glycine - 3/20
GMP - 2/20
 RS: URS0000D84B4C_29367
MFE: -11.968
Ligand: cyclic-di-GMP
Species: Clostridium puniceum Cyclic di-GMP-II riboswitch
 RS: URS0000C0E45E_1795630
MFE: -33.702
Ligand: zmp-ztp
Species: Frondihabitans sp. PAMC 28766 ZMP/ZTP riboswitch
 RS: URS0000C760F5_1543381
MFE: -28.696
Ligand: glycine
Species: Oleiagrimonas soli Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA075339-0 URS0000D84B4C_29367 URS0000C0E45E_1795630 URS0000C760F5_1543381
Length 84. 83. 84. 85.
Similarity - 0.982 0.981 0.981
Ensemble Norm 0.985 - - -
MFE -30.979 -11.968 -33.702 -28.696
Ligands - cyclic-di-GMP zmp-ztp glycine
Gene OS9 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.003 2.001 2.002
Length SE - 1. 0. 1.
Lev Distance - 21. 25. 24.
UBS 5. 5. 5. 5.
BS 0. 0. 0. 0.
ILL 2. 2. 2. 2.
ILR 0. 2. 1. 0.
H 2. 2. 2. 3.
BL 0. 1. 1. 0.
BR 1. 1. 1. 0.
UN 0.226 0.277 0.190 0.176

Sequences

Field Description
UTR seq + 25 cugaccaaucacggacagcgauugauauuucuaaucgucgugauccaccuccccaggacATGGCGGCGGAAACGCTGCTGTCCA
UTR dot + 25 …….((((((….((((((((….)).))))))))))))………..((((..(((((((….))))))))))).
RS 1 seq UAAAAAGUUGGAAACGAGGAUGGAUUCUUUUAUUUGGGCACCUUAAGAAUUCGGAGUUAGUGGUGCAACCUGCCAGCAAUUAA
RS 1 dot ……(((.(((..(((((…..)))))..))).)))……………((((..((((…….))))..))))..
RS 2 seq UCGACGGGUCGCGACUGGCGUUCGGGUGGUCAACCACCGGGGAGCGACUCACACGGUUGGUGGCCGUACGCCUGGGCCAUCUCG
RS 2 dot …..(((((((..(…….(.(((((….))))).))..)))))))……..(((((((………)))))))…
RS 3 seq UAACACCCGGUGGGAGAAGCGGGGCAACCCGCUGCCGAAGGCGCAACGCCCGUAAUCGCUCAGGCUCCCGUACCACCGCCGCGAA
RS 3 dot …….((((……((((((….))))))))))..((((…))))…..((((…(((…………))))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table