Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA075443 Similarity: 0.983 Similarity: 0.982 Similarity: 0.981
UTR: 5HSAA075443
Gene: OSBPL2
MFE: -11.592
ENS: 0.986
Length: 83.
Predicted Ligands:
zmp-ztp - 6/20
GMP - 4/20
cyclic-di-GMP - 4/20
 RS: URS0000D6B49A_12908
MFE: -19.
Ligand: GMP
Species: unclassified sequences c-di-GMP-II-AAU riboswitch
 RS: URS0000C8553B_525245
MFE: -33.151
Ligand: zmp-ztp
Species: Actinomyces coleocanis DSM 15436 ZMP/ZTP riboswitch
 RS: URS0000D96938_1805400
MFE: -16.617
Ligand: cyclic-di-GMP
Species: bacterium CG2_30_33_46 Cyclic di-GMP-II riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA075443 URS0000D6B49A_12908 URS0000C8553B_525245 URS0000D96938_1805400
Length 83. 84. 83. 84.
Similarity - 0.983 0.982 0.981
Ensemble Norm 0.986 - - -
MFE -11.592 -19. -33.151 -16.617
Ligands - GMP zmp-ztp cyclic-di-GMP
Gene OSBPL2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.002 2.004 3.014
Length SE - 1. 0. 1.
Lev Distance - 21. 24. 24.
UBS 7. 6. 6. 7.
BS 0. 0. 0. 0.
ILL 3. 3. 3. 3.
ILR 1. 1. 1. 2.
H 1. 1. 1. 1.
BL 3. 2. 2. 2.
BR 3. 2. 3. 4.
UN 0.048 0. 0.108 0.167

Sequences

Field Description
UTR seq + 25 auaagacucgcccauucugaauggacacuuaagugauuuuuaguaaauugaccgaaucATGCCAATCGCCTTCAACGAGCCTC
UTR dot + 25 …((.((((…….(((.(((.((……((((((…((……)).))))))))))).)))…….)))).)).
RS 1 seq UACUCAAGUUGAGCGUCGAGACUCGUUUUAUAUAUUGGUUGCUUGAAACGAGAGGAGCUAGUAGCGAAACCUCCAGCUUUAGUG
RS 1 dot ((((.((((((……(((..((((……((((((((.(((…….))).))))))))))))…))))))))).))))
RS 2 seq UGGAAGUGUCGUAACUGGCGCAGGUGGAAUACCACCGGGGAGCGAUAACCUGGCCUCGCUGGCCGCCCGCCUGGGUCUGCGAG
RS 2 dot ……..(((((…(((.(((((((….(((.(((((..((……)).))))).)))….))))))).)))))))).
RS 3 seq UUUAUAUAGAGAAGCGAGGAAGUGUAAUCCGUAUCUGGGCACCUGGAUUACAUGGAGCUAUUGAUGCAACCGGCUCUAUUCGUA
RS 3 dot ………….(((((..((.((…..(((((..(((.((((…..)).)).)))…)))))…..)).)).))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table