Detected as a riboswitch by 3 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA075452 Similarity: 0.987 Similarity: 0.986 Similarity: 0.985
UTR: 5HSAA075452
Gene: OSBPL3
MFE: -8.407
ENS: 0.659
Length: 64.
Predicted Ligands:
fluoride - 14/20
cobalamin - 4/20
unknown - 2/20
 RS: URS0000AB8807_1274
MFE: -22.008
Ligand: cobalamin
Species: Dermacoccus nishinomiyaensis Cobalamin riboswitch
 RS: URS0000DB45D3_1938746
MFE: -20.042
Ligand: cobalamin
Species: Blastococcus sp. DSM 44272 Cobalamin riboswitch
 RS: URS0000C2603C_1423792
MFE: -12.232
Ligand: fluoride
Species: Lactobacillus perolens DSM 12744 Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA075452 URS0000AB8807_1274 URS0000DB45D3_1938746 URS0000C2603C_1423792
Length 64. 64. 64. 65.
Similarity - 0.987 0.986 0.985
Ensemble Norm 0.659 - - -
MFE -8.407 -22.008 -20.042 -12.232
Ligands - cobalamin cobalamin fluoride
Gene OSBPL3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.006 2.012 5.002
Length SE - 0. 0. 1.
Lev Distance - 16. 18. 18.
UBS 5. 4. 5. 4.
BS 0. 0. 0. 0.
ILL 2. 1. 2. 1.
ILR 2. 1. 1. 1.
H 2. 2. 2. 2.
BL 0. 1. 0. 1.
BR 1. 0. 2. 0.
UN 0.094 0.172 0.203 0.138

Sequences

Field Description
UTR seq + 25 ggauaagccaaccuuuauaggccaagugacuugcuguccATGATGAGTGATGAGAAGAACCTTG
UTR dot + 25 ……(((……….)))((((…(((..(((((…….).))))..)))…))))
RS 1 seq GGAAUGCCGGUGCGAAUCCGGCAGCGGUCCCGCCACUGUGAUCCCCGACGGGGUAAGCCAGGAC
RS 1 dot ….((((((…….))))))..(((…(((.((((……..)))))))..)))…..
RS 2 seq GAGGAAGCCGGUGCGAAUCCGGCGCGGUCCCGCCACUGUGAGCCUUCGGGUGAGCCAGACACUC
RS 2 dot ……(((((…….)))))…(((..((((((..((….)).)))).))..)))….
RS 3 seq CAUCUAAUCGGUGAUGACGUUCGCCGUAACCAUUACAGAACGUAAUUAAUGACGUCUACAGUUGC
RS 3 dot ………(((((……)))))(((((……((.((((……..))))))…)))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table