Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA075588 Similarity: 0.970 Similarity: 0.969 Similarity: 0.969
UTR: 5HSAA075588
Gene: OSGEPL1
MFE: -22.662
ENS: 0.989
Length: 111.
Predicted Ligands:
TPP - 10/20
SAM - 6/20
cobalamin - 2/20
 RS: URS0000C20EFB_1581037
MFE: -23.222
Ligand: TPP
Species: Bacillus sp. FJAT-22058 TPP riboswitch (THI element)
 RS: URS0000C59EDB_363870
MFE: -25.848
Ligand: SAM
Species: Bacillus ginsengihumi SAM riboswitch (S box leader)
 RS: URS0000C1485D_1735683
MFE: -47.226
Ligand: TPP
Species: Sphingomonas sp. Leaf17 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA075588 URS0000C20EFB_1581037 URS0000C59EDB_363870 URS0000C1485D_1735683
Length 111. 110. 112. 112.
Similarity - 0.970 0.969 0.969
Ensemble Norm 0.989 - - -
MFE -22.662 -23.222 -25.848 -47.226
Ligands - TPP SAM TPP
Gene OSGEPL1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 11.010 9.006 15.030
Length SE - 1. 1. 1.
Lev Distance - 35. 38. 36.
UBS 6. 8. 6. 9.
BS 0. 0. 0. 0.
ILL 3. 2. 1. 3.
ILR 3. 2. 2. 3.
H 3. 4. 3. 4.
BL 0. 2. 2. 2.
BR 0. 0. 0. 1.
UN 0.252 0.155 0.330 0.080

Sequences

Field Description
UTR seq + 25 guucuuugguaacccugcuagggggcgccgcuagauuccauccuauuucuccgaugaaaguaucaggaauuaucuauagaguaaguATGCTAATCTTGACTAAGACTGCAG
UTR dot + 25 …….(((..((((….))))..)))….((((((……((((……))))……))))))…………….(((…((((….))))..))).
RS 1 seq AUUUAAUGUUACGGGAGUCUGUGGAAUCAGGCUGAGAGUAUGACUAACUGUUGUAGACCGUUUGAACCUGUUGGGUAAUGCCAGCGUAGGGAUUGUGACUAGAGGACCAC
RS 1 dot ……..((((((….))))))..((((((.(.(..((((((…..))))))..))))))))…((((((……))))))..((..((……..))..))..
RS 2 seq UUCUUAUCAAGAGAGGUGGAGGGACUGGCCCUAUGAAGCCUCAGCAACCAGCCAAACAUGGUCAGGUGCUAAUUCCAGCAAACAAGUAUUGUCAUUGUUUGACAGAUAAGAA
RS 2 dot …………(((((..((((…..))))…..)))))(((.(((.((((….))))..))))))………………((((((…..))))))…….
RS 3 seq GCCGCAUCCCCGGGGGACCGCUGAUGCGCGGUUGAGAGGUGGCCAGUUCAGGCCACGACCCGCUGAACCUGAUCCGGUUGACACCGGCGGAGGGAGGGAGCGGCUUUCGCCU
RS 3 dot ..((((((..(((….)))..))))))((((.(.(..((((((……))))))..)).))))((((……))))……((((((((..(….)..)))))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table