Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA075640 Similarity: 0.954 Similarity: 0.953 Similarity: 0.951
UTR: 5HSAA075640
Gene: OTP
MFE: -36.703
ENS: 0.944
Length: 173.
Predicted Ligands:
cobalamin - 6/20
lysine - 5/20
TPP - 3/20
 RS: URS000232694B_1424294
MFE: -49.221
Ligand: cobalamin
Species: Geosporobacter ferrireducens Cobalamin riboswitch
 RS: URS0002312549_1321781
MFE: -52.557
Ligand: cobalamin
Species: Mitsuokella sp. oral taxon 131 str. W9106 Cobalamin riboswitch
 RS: URS000231E1C2_1895746
MFE: -33.077
Ligand: cobalamin
Species: Clostridiales bacterium 38-18 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA075640 URS000232694B_1424294 URS0002312549_1321781 URS000231E1C2_1895746
Length 173. 173. 172. 172.
Similarity - 0.954 0.953 0.951
Ensemble Norm 0.944 - - -
MFE -36.703 -49.221 -52.557 -33.077
Ligands - cobalamin cobalamin cobalamin
Gene OTP - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 13.007 2.007 3.011
Length SE - 0. 1. 1.
Lev Distance - 54. 61. 63.
UBS 13. 14. 13. 14.
BS 0. 0. 0. 0.
ILL 3. 2. 3. 4.
ILR 5. 4. 4. 5.
H 3. 3. 3. 3.
BL 5. 4. 5. 5.
BR 4. 7. 3. 5.
UN 0.023 0.104 0.105 0.128

Sequences

Field Description
UTR seq + 25 cccccuuuuuaaccacaaaccgaauuuucuuucauuuaggugaucuauauauaucuauaucguauagcuuauagcuuauaucuauuuuaaauaacuuaaagccgcuaaaauuugggggggaacagcuuucgcccuggagcggugcgcgATGCTGTCTCATGCCGACCTCCTGG
UTR dot + 25 (((((…………..(((((((((……(((((((((..((.(((((.(((((……….)))))..))))).))..))…..)))))))……))))))))))))))….((….))((.(((((((((.(.(((…))).).)))))..)))).))
RS 1 seq AAUUAAAUCUACACUAUAGGUGCCCCUUUGGGGAGAAUAGGGAAUGAAGUGAAAUGCUUCAGCGGUCCCACCACUGUAAAGAGGAGUUUUGCACAUUUAACCACUGGUUUUCCGGGAAGGGGUGUAAAACGUUGAAUCUGAGCCAGGAGACCUGCCUAUAGAAAUCUAGCGUC
RS 1 dot ………..((((…))))(((((((..(((((((((((((((..(((((((.((((.(((((……)))))…)))).))))))).))))…)).))).))))))..)))))))……(((((((.((((((.((((…)))).)).))))..)).))))).
RS 2 seq AUACAAAUUAGCAGGUUCGGUGCCCCUCGGGGCGUAACAGGGAAAUCGGUGCAAUGCCGAUGCGGUCCCGCCGCCGUAAUGCUGAGGAUGCCCGAAUAUGUCACUGGGAGACUGGGAAGGCAGGGCAACGAUGAAGCAGAGCCGGAAGACCUACCGAAUCUUGUACGUCGGA
RS 2 dot …………..((((((.((.((((((((((…(.((((.((((((…..))))))….))))).))))……))))))..)))))))).((((.(((…………..))))))).(((((..(((((..(((……..)))..))).)).)))))..
RS 3 seq UAGAAUGAAACUGUUAUAGGUGCCGAUAAAUUGGAGAAUAGGGAAUUAGGUGAAAAUCCUAAGCGAACCCAUCACUGUAAGACGGAGCGAACGCAUAUGCCACUGGGAAACUGGGAAGGCGCGAUCAGCGUUGAUGUUGAGCCAGGAGACCUGCCUGUAAUUGAAUCAAUGG
RS 3 dot ……………….((.(((…..(((.((….(((..(((((…….)))))…..)))….)).)))..))).))((.(((….(((.((((….))))…)))))).))..(((((((((((((.((((…)))).)).))))…))))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table