Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA075721 Similarity: 0.966 Similarity: 0.964 Similarity: 0.964
UTR: 5HSAA075721
Gene: OXSM
MFE: -26.571
ENS: 0.657
Length: 124.
Predicted Ligands:
TPP - 7/20
cobalamin - 6/20
methionine - 3/20
 RS: URS0000D7F7E7_1817851
MFE: -30.852
Ligand: TPP
Species: Candidatus Edwardsbacteria bacterium GWF2_54_11 TPP riboswitch (THI element)
 RS: URS0000BE3845_1587522
MFE: -56.267
Ligand: methionine
Species: Rhodococcus sp. MEB064 S-adenosyl methionine (SAM) riboswitch,
 RS: URS0000D985B2_1816218
MFE: -25.617
Ligand: TPP
Species: Colwellia sp. PAMC 20917 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA075721 URS0000D7F7E7_1817851 URS0000BE3845_1587522 URS0000D985B2_1816218
Length 124. 124. 125. 122.
Similarity - 0.966 0.964 0.964
Ensemble Norm 0.657 - - -
MFE -26.571 -30.852 -56.267 -25.617
Ligands - TPP methionine TPP
Gene OXSM - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7. 4.004 1.005
Length SE - 0. 1. 4.
Lev Distance - 42. 45. 43.
UBS 11. 11. 10. 10.
BS 0. 0. 0. 0.
ILL 1. 3. 1. 1.
ILR 1. 2. 0. 1.
H 4. 3. 5. 4.
BL 4. 3. 4. 4.
BR 4. 4. 3. 4.
UN 0.177 0.194 0.112 0.246

Sequences

Field Description
UTR seq + 25 gugcgcgugcgcuugagagcgucaucgcccccgacuguggagaaguguccgggguagccccguuacaggaauguguuucugaucaucugaaucuuaaucATGTCCAACTGCCTGCAAAATTTCC
UTR dot + 25 ..(((.(((((((….)))).))))))(((.(((………..))).)))(((((…))))).((.(((((.((..((((….)).))..)).)))))))……………….
RS 1 seq CGUAACAGCUGGGGGAGCAUAAGGCGUAAGAUGCCAGGCUGAGAGGCCCGAUCAAUUGAAAGAUAGGGCGACCCCUUAACCUGAACUGGGUAACACCAGCGGAGGGAAGCGCAAAUAACAGGUA
RS 1 dot …..(((((((.((.((…..)).)….).)))).))).(..((((.(((……..))).))))..)((((….(((..((((……)))))))))))………………
RS 2 seq GGUCAUGAGCGCCAGCAUCGAGCCCCGGCUUGCUGGCCGGCAACCCUCCAACCGCGGUGGGGUGCCCCGGGUGAUGACCGGGUUACUCGGUCCGUGAUCGUGCGGAGCGAGAGCAAGCGCGGGCC
RS 2 dot ……….(((((((…(((….)))))))))).((((.(((.((……)).))).))))((((…….))))(((.((((.(((((……))))).)))))))..((….)).
RS 3 seq AAUUACUUGUCGGAGUGCUGAGAUUAUUUCUAAAGAAAUAUUCAAAGCUGAGAUCGCGAAAGCGGGAUCCGUAGAACCUGAUCAGAUUAAUAUCUGCGUAAGGGAACAAGGUAAAAUAUAGC
RS 3 dot ….((((….))))(((..((.((((((….)))))).))..))).(.((((.((….)).)))))……(((.(((((((….))))).)).)))……………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table