Detected as a riboswitch by 14 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA075722 Similarity: 0.969 Similarity: 0.969 Similarity: 0.969
UTR: 5HSAA075722
Gene: OXSM_0
MFE: -31.358
ENS: 0.837
Length: 132.
Predicted Ligands:
TPP - 13/20
cobalamin - 3/20
SAM - 2/20
 RS: URS0000BE2543_1348663
MFE: -54.015
Ligand: TPP
Species: Kitasatospora cheerisanensis KCTC 2395 TPP riboswitch (THI element)
 RS: URS0000AB733A_501479
MFE: -51.103
Ligand: TPP
Species: Citreicella sp. SE45 TPP riboswitch (THI element)
 RS: URS0002312E76_463642
MFE: -52.967
Ligand: cobalamin
Species: Streptomyces sp. F-1 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA075722 URS0000BE2543_1348663 URS0000AB733A_501479 URS0002312E76_463642
Length 132. 134. 131. 132.
Similarity - 0.969 0.969 0.969
Ensemble Norm 0.837 - - -
MFE -31.358 -54.015 -51.103 -52.967
Ligands - TPP TPP cobalamin
Gene OXSM - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.001 3. 6.004
Length SE - 4. 1. 0.
Lev Distance - 34. 39. 39.
UBS 11. 10. 11. 11.
BS 0. 0. 0. 0.
ILL 3. 2. 2. 4.
ILR 3. 3. 2. 2.
H 4. 4. 4. 4.
BL 3. 2. 4. 3.
BR 3. 2. 3. 1.
UN 0.106 0.075 0.122 0.045

Sequences

Field Description
UTR seq + 25 acgugcgugugcgcgugcgcucgagagcgucaucgcccccgacuguggagaaguguccgggguagccccguuacaggaauguguuucugaucaucugaaucuuaaucATGTCCAACTGCCTGCAAAATTTCC
UTR dot + 25 ((((((….))))))(((((….)))))….(((((.(((………..))).))))).((…((….((.(((((.((..((((….)).))..)).)))))))….))..))………
RS 1 seq CCCGCGCGGAACGGGAGCUCGGAGCACCGGGCUGAGAGGGCGCUGACGGUACGCGGACCCGCGGACCACCUGCUGCGCCGACCGCAGGAACCUGACCGGGUAAUGCCGGCGUAGGGAGUUGAAGGUCCGAUGAC
RS 1 dot ((((…….))))(((((((….)))))))….((((((………)))..))).((((((((.(.((((((((…(((…((((….))))..))))))))))).).))….))))))…..
RS 2 seq UACCCACGUCAGGGGAGUCCCGCCUAGGGGACUGAGAGGCUGACAGGGCGCUGUUUCGCACAGGCCCGGUGACGCGACCCUUUGAACCUGACCCAGUUGACGCUGGCGUAGGAAGACCGAAGGGCAAUCCC
RS 2 dot ..(((.(….))))((((((……))))))…..(((.((.((((.((((…..)))))))).)).).))..(((((((..((((..(((((….)))))..))))…..)))))))…….
RS 3 seq CUGCCGGUAAAGUGGCGGGGUCGUCAUCACACCCGUACGGGGGAAAGCCGGUGCAAUUCCGGCGCUGACCCGCAACCGUGAGCCGUUUCCCCGCGGAGCGGCGAGCCGGAACGCCCCGGGGGGCACGUUGAC
RS 3 dot ((((((……))))))(((.((….)))))….((((..(..(((((…….)))))..)..))))(((.((((……..((((.(((…((((……..))))))).)))))))))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table