Detected as a riboswitch by 13 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA075934 Similarity: 0.956 Similarity: 0.956 Similarity: 0.956
UTR: 5HSAA075934
Gene: PA2G4
MFE: -62.789
ENS: 0.887
Length: 147.
Predicted Ligands:
FMN - 7/20
cobalamin - 5/20
molybdenum - 3/20
 RS: URS0000C0EB04_1759557
MFE: -45.237
Ligand: FMN
Species: Sporosarcina sp. HYO08 FMN riboswitch (RFN element)
 RS: URS0000C75A6E_1476
MFE: -46.837
Ligand: FMN
Species: Sporosarcina psychrophila FMN riboswitch (RFN element)
 RS: URS0000D6A665_12908
MFE: -29.143
Ligand: Ni/Co
Species: unclassified sequences NiCo riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA075934 URS0000C0EB04_1759557 URS0000C75A6E_1476 URS0000D6A665_12908
Length 147. 147. 148. 146.
Similarity - 0.956 0.956 0.956
Ensemble Norm 0.887 - - -
MFE -62.789 -45.237 -46.837 -29.143
Ligands - FMN FMN Ni/Co
Gene PA2G4 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 19.008 19.008 34.
Length SE - 0. 1. 1.
Lev Distance - 52. 51. 45.
UBS 8. 10. 10. 11.
BS 3. 0. 0. 0.
ILL 0. 0. 0. 3.
ILR 0. 1. 1. 1.
H 4. 5. 5. 3.
BL 6. 4. 4. 4.
BR 2. 2. 2. 3.
UN 0.143 0.231 0.230 0.137

Sequences

Field Description
UTR seq + 25 gcuacugaggggcccgcaccgguccgcugggcacggcguggugggaagacccggugucgcgccugggaccugagcgggcaggcccaggcugaagucuauggaggugcgggucggcgaccaggATGTCGGGCGAGGACGAGCAACAGG
UTR dot + 25 ……….((((((((((..((((.(((((.((.((.(((……))))).))(((.(((((((.((((……)))))))))))))).)))))))))))))))))))..((((……)))).((……..))……
RS 1 seq CAAACUCUUCGGGGCAAGGUGAAAUUCCUUACCGGCGGUGAUCGAGCUUGGCUCGUCAGUCCGUGACCCGUCCUUCCCUUAUGGAAGGCGGUGGAGCUGGUGUAAAUCCGGCACCGACAGUGAUAGUCUGGAUGGGAGAAGUUGUUU
RS 1 dot …………((.((((…….)))).)).(((((((.(((((…))))))))..))))…(((.((((((…..)))))))))(((.(((((…….))))).))).(((…….)))……………..
RS 2 seq CAAACUCUUCGGGGCAAGGUGAAAUUCCUUACCGGCGGUGAUCGAGCAUAGCUCGUCAGUCCGUGACCCGUCCUUCCUUGCUUGGAAGGCGGUGGAGCUGGUGAAAUUCCGGCACCGACAGUUAUAGUCUGGAUGGGAGAAGUUGUUU
RS 2 dot …………((.((((…….)))).)).(((((((.(((((…))))))))..))))…(((.((((((……)))))))))(((.(((((…….))))).))).(((…….)))……………..
RS 3 seq ACAGUACAAACUGAGCAGACCGGAAUUAUAUGAUAUAUAUGUUUGUUAUGUGAUAAUAAGAUUAAAUCACAUCAUAAUAUAAAAGUGUAAUCCAGGAGUCGGGUCACAUGUGUGACAGUGGAAUCUUUUCUAUCCACGGGACAGUA
RS 3 dot ……….((((.(…((((.(((((((..(…((((.((((.(((((((………..))))))).)))))))))..))))))))).)).)))))(((((….))))).(((((……….)))))………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table